Transcript: Human XM_005271322.4

PREDICTED: Homo sapiens nexilin F-actin binding protein (NEXN), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NEXN (91624)
Length:
7949
CDS:
189..2219

Additional Resources:

NCBI RefSeq record:
XM_005271322.4
NBCI Gene record:
NEXN (91624)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005271322.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425615 ACGGAAGCATAAGCTAGAAAT pLKO_005 1376 CDS 100% 13.200 18.480 N NEXN n/a
2 TRCN0000431373 CATCAGATTTATCGCCTATTA pLKO_005 2401 3UTR 100% 13.200 18.480 N NEXN n/a
3 TRCN0000414989 AGTGGCTCTATTCAAGCTAAA pLKO_005 1506 CDS 100% 10.800 15.120 N NEXN n/a
4 TRCN0000123131 CGAGGCTCCATTTACTCACAA pLKO.1 1697 CDS 100% 4.950 6.930 N NEXN n/a
5 TRCN0000413979 ACTTGGCAAGGGTGATGTAAA pLKO_005 263 CDS 100% 13.200 10.560 N NEXN n/a
6 TRCN0000123129 GCCACTATGCTGACTTCTTAT pLKO.1 2315 3UTR 100% 13.200 9.240 N NEXN n/a
7 TRCN0000123130 GCCTTTACTTACCAGAAACTT pLKO.1 2101 CDS 100% 5.625 3.938 N NEXN n/a
8 TRCN0000123132 CCAGAAATTACATGGTGGTTT pLKO.1 2019 CDS 100% 4.950 3.465 N NEXN n/a
9 TRCN0000123133 GCTGAACAGATTGAGGACATA pLKO.1 627 CDS 100% 4.950 3.465 N NEXN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005271322.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12965 pDONR223 100% 83.7% 83.4% None (many diffs) n/a
2 ccsbBroad304_12965 pLX_304 0% 83.7% 83.4% V5 (many diffs) n/a
3 TRCN0000469025 GACGATTCATCCAGGCGCGGTGTG pLX_317 27.2% 83.7% 83.4% V5 (many diffs) n/a
4 ccsbBroadEn_12966 pDONR223 100% 81.9% 81.8% None 1_324del;446_487del;733G>A n/a
5 ccsbBroad304_12966 pLX_304 0% 81.9% 81.8% V5 1_324del;446_487del;733G>A n/a
6 TRCN0000480865 TCTTTGGATCACGCATAGGCGATG pLX_317 22.9% 81.9% 81.8% V5 1_324del;446_487del;733G>A n/a
Download CSV