Transcript: Human XM_005273120.3

PREDICTED: Homo sapiens inositol-trisphosphate 3-kinase B (ITPKB), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ITPKB (3707)
Length:
3136
CDS:
462..2396

Additional Resources:

NCBI RefSeq record:
XM_005273120.3
NBCI Gene record:
ITPKB (3707)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005273120.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195620 CATACCTGCTGTCATCATTAC pLKO.1 2156 CDS 100% 10.800 8.640 N ITPKB n/a
2 TRCN0000431828 ACCAGAAAGTGGGCATGTTTG pLKO_005 892 CDS 100% 10.800 7.560 N ITPKB n/a
3 TRCN0000037713 ACAGCTATGGAAATTGACAAA pLKO.1 1272 CDS 100% 4.950 3.465 N ITPKB n/a
4 TRCN0000422702 AGACGACTGTGAGCGTGCAAA pLKO_005 1645 CDS 100% 4.950 3.465 N ITPKB n/a
5 TRCN0000037712 CTCGCAGGTGAAGAAAGGAAT pLKO.1 1142 CDS 100% 4.950 3.465 N ITPKB n/a
6 TRCN0000197165 GACGCTGCGAAAGATCTGAAA pLKO.1 1908 CDS 100% 4.950 3.465 N ITPKB n/a
7 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2999 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005273120.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10928 pDONR223 100% 99.8% 99.5% None 518G>A;1222T>G;1655C>A n/a
2 ccsbBroad304_10928 pLX_304 0% 99.8% 99.5% V5 518G>A;1222T>G;1655C>A n/a
3 TRCN0000471139 GACACCTTCTTAACTGTTGTGGTC pLX_317 22.2% 99.8% 99.5% V5 518G>A;1222T>G;1655C>A n/a
4 ccsbBroadEn_14677 pDONR223 0% 99.8% 99.5% None 518G>A;1222T>G;1655C>A n/a
5 ccsbBroad304_14677 pLX_304 33.2% 99.8% 99.5% V5 518G>A;1222T>G;1655C>A n/a
6 TRCN0000491832 AAATGGCACGCTTGATCTCGCTGT pLX_317 21.4% 99.8% 99.5% V5 518G>A;1222T>G;1655C>A n/a
Download CSV