Transcript: Mouse XM_006495514.1

PREDICTED: Mus musculus sulfatase 1 (Sulf1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sulf1 (240725)
Length:
5213
CDS:
285..3650

Additional Resources:

NCBI RefSeq record:
XM_006495514.1
NBCI Gene record:
Sulf1 (240725)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006495514.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175934 GCTATAACTATGCACCGAACA pLKO.1 1027 CDS 100% 4.050 5.670 N Sulf1 n/a
2 TRCN0000176275 CGTGCATAACCACAATGTCTA pLKO.1 581 CDS 100% 4.950 3.960 N Sulf1 n/a
3 TRCN0000215401 CATTCCAGAAGTGAATCATTT pLKO.1 3251 CDS 100% 13.200 9.240 N Sulf1 n/a
4 TRCN0000174816 GAGCTATTACAACAAAGAGAA pLKO.1 2321 CDS 100% 4.950 3.465 N Sulf1 n/a
5 TRCN0000174708 GCCTACATTGATAAAGAGATT pLKO.1 2211 CDS 100% 4.950 3.465 N Sulf1 n/a
6 TRCN0000173380 GCCCAAATATGAGAGGGTCAA pLKO.1 1589 CDS 100% 4.050 2.835 N Sulf1 n/a
7 TRCN0000216401 GATGTTGCCTAACATAATATT pLKO.1 3655 3UTR 100% 1.500 1.050 N Sulf1 n/a
8 TRCN0000194028 GCTCCTACCATTCTGGATATT pLKO.1 1377 CDS 100% 13.200 7.920 N Sulf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006495514.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489537 CCCGTCCTGAATGCGCACCTCTTC pLX_317 15% 65.4% 70.8% V5 (many diffs) n/a
2 TRCN0000489880 TATCTAGATAGGGCTCACAGCACC pLX_317 17% 65.5% 70.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_11696 pDONR223 100% 47.9% 49.2% None (many diffs) n/a
4 ccsbBroad304_11696 pLX_304 0% 47.9% 49.2% V5 (many diffs) n/a
5 TRCN0000470613 TTACCGGTAGAGGTGTGCAACAGT pLX_317 22.3% 47.9% 49.2% V5 (many diffs) n/a
Download CSV