Transcript: Mouse XM_006495797.2

PREDICTED: Mus musculus DNA primase, p58 subunit (Prim2), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prim2 (19076)
Length:
898
CDS:
176..883

Additional Resources:

NCBI RefSeq record:
XM_006495797.2
NBCI Gene record:
Prim2 (19076)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006495797.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111466 GCCATTATCTTGAACGAGTTT pLKO.1 821 CDS 100% 4.950 3.960 N Prim2 n/a
2 TRCN0000326546 GCCATTATCTTGAACGAGTTT pLKO_005 821 CDS 100% 4.950 3.960 N Prim2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006495797.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15536 pDONR223 0% 55.1% 58.2% None (many diffs) n/a
2 ccsbBroad304_15536 pLX_304 0% 55.1% 58.2% V5 (many diffs) n/a
3 TRCN0000475396 GAGTCATTGGTGCACCTCATGTTC pLX_317 78.3% 55.1% 58.2% V5 (many diffs) n/a
4 ccsbBroadEn_06769 pDONR223 100% 37.8% 40.7% None (many diffs) n/a
5 ccsbBroad304_06769 pLX_304 0% 37.8% 40.7% V5 (many diffs) n/a
6 TRCN0000473120 TGATGACTGGCATGTACAAGCACC pLX_317 27.1% 37.8% 40.7% V5 (many diffs) n/a
Download CSV