Transcript: Mouse XM_006496401.2

PREDICTED: Mus musculus SPEG complex locus (Speg), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Speg (11790)
Length:
8647
CDS:
195..7778

Additional Resources:

NCBI RefSeq record:
XM_006496401.2
NBCI Gene record:
Speg (11790)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496401.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419808 CTCCGTTACCTGGACTCATTT pLKO_005 1283 CDS 100% 13.200 18.480 N Speg n/a
2 TRCN0000416372 GCAAGGCGGTCAACGAATATG pLKO_005 829 CDS 100% 13.200 18.480 N Speg n/a
3 TRCN0000426085 CAGCGACAGATTCCGGTATTC pLKO_005 7127 CDS 100% 10.800 15.120 N Speg n/a
4 TRCN0000078756 CGAAACTACAACGTGGCATTT pLKO.1 3432 CDS 100% 10.800 15.120 N Speg n/a
5 TRCN0000078754 GCGCTCTCAAATCAGCTACAA pLKO.1 3638 CDS 100% 4.950 6.930 N Speg n/a
6 TRCN0000078755 CCGAAACTACAACGTGGCATT pLKO.1 3431 CDS 100% 4.050 5.670 N Speg n/a
7 TRCN0000078753 GCCCTCCTTCCCATTTGTATT pLKO.1 8455 3UTR 100% 13.200 9.240 N Speg n/a
8 TRCN0000078757 GCTGGTGTCTATAAGAGTGTA pLKO.1 1767 CDS 100% 4.950 3.465 N Speg n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496401.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488546 TAATCTTAGTTCATACATGCTTTC pLX_317 58.7% 5.9% 6.2% V5 (many diffs) n/a
2 TRCN0000488863 GAAACGTACAGGTATTCTTTTTCG pLX_317 59.5% 5.9% 6.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_02387 pDONR223 100% 3.8% 4.1% None (many diffs) n/a
4 ccsbBroad304_02387 pLX_304 0% 3.8% 4.1% V5 (many diffs) n/a
5 TRCN0000467901 AATAATGACTCCTACGGATTTTGC pLX_317 77.9% 3.8% 4.1% V5 (many diffs) n/a
Download CSV