Transcript: Mouse XM_006496408.1

PREDICTED: Mus musculus Eph receptor A4 (Epha4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Epha4 (13838)
Length:
6198
CDS:
78..2885

Additional Resources:

NCBI RefSeq record:
XM_006496408.1
NBCI Gene record:
Epha4 (13838)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496408.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321954 GCAATTGCGTATCGTAAATTT pLKO_005 2307 CDS 100% 15.000 21.000 N Epha4 n/a
2 TRCN0000321884 GTAAACCGGTAATGATCATAA pLKO_005 1999 CDS 100% 13.200 18.480 N Epha4 n/a
3 TRCN0000361185 ATCAGCCGAAGACGGAGTAAG pLKO_005 1629 CDS 100% 10.800 15.120 N Epha4 n/a
4 TRCN0000321953 TGAATGGAGTGTCTAAGTATA pLKO_005 1171 CDS 100% 13.200 10.560 N Epha4 n/a
5 TRCN0000321952 AGAAGTGACAGGCCTAAATTT pLKO_005 2517 CDS 100% 15.000 10.500 N Epha4 n/a
6 TRCN0000368777 ATCGATGCATCCTGCATTAAA pLKO_005 1770 CDS 100% 15.000 10.500 N Epha4 n/a
7 TRCN0000361186 GCTTTCAGGGCTCGGTTTATA pLKO_005 3357 3UTR 100% 15.000 10.500 N Epha4 n/a
8 TRCN0000321885 TAAACCTGGAGCCAGTAATTT pLKO_005 3099 3UTR 100% 15.000 10.500 N Epha4 n/a
9 TRCN0000023562 CCCTGGAAGTCACTACTAATA pLKO.1 1504 CDS 100% 13.200 9.240 N Epha4 n/a
10 TRCN0000023563 CGACCAAATGGAGTCATCTTA pLKO.1 1320 CDS 100% 5.625 3.938 N Epha4 n/a
11 TRCN0000010161 GCCAGGAACACAGATATCAAA pLKO.1 1407 CDS 100% 5.625 3.938 N EPHA4 n/a
12 TRCN0000023560 GCACACACCAATTACACGTTT pLKO.1 1137 CDS 100% 4.950 3.465 N Epha4 n/a
13 TRCN0000023561 CCACTGAGCAAGAAAGGGTTT pLKO.1 447 CDS 100% 4.050 2.835 N Epha4 n/a
14 TRCN0000010153 CCAAGCAGCACCATCATCCAT pLKO.1 1235 CDS 100% 3.000 2.100 N EPHA4 n/a
15 TRCN0000196950 GACTTGCAAGGAGACGTTTAA pLKO.1 272 CDS 100% 13.200 7.920 N EPHA4 n/a
16 TRCN0000344511 GACTTGCAAGGAGACGTTTAA pLKO_005 272 CDS 100% 13.200 7.920 N EPHA4 n/a
17 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3658 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496408.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14627 pDONR223 0% 85.7% 93.4% None (many diffs) n/a
2 ccsbBroad304_14627 pLX_304 0% 85.7% 93.4% V5 (many diffs) n/a
3 TRCN0000480032 GCTATGCCGAACCCCACGACAGTT pLX_317 10.9% 85.7% 93.4% V5 (many diffs) n/a
4 TRCN0000488992 TTACAATGCTTAACTTCGTTATCT pLX_317 27.3% 38.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV