Transcript: Mouse XM_006496642.2

PREDICTED: Mus musculus opsin 3 (Opn3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Opn3 (13603)
Length:
1377
CDS:
59..907

Additional Resources:

NCBI RefSeq record:
XM_006496642.2
NBCI Gene record:
Opn3 (13603)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496642.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221333 CGACTGAGCAAGACAAATTAT pLKO.1 1051 3UTR 100% 15.000 21.000 N Opn3 n/a
2 TRCN0000221335 CGCATCTAAGGTCGATGTCAT pLKO.1 868 CDS 100% 4.950 6.930 N Opn3 n/a
3 TRCN0000221337 CATTACCTATATCTGGCTCTA pLKO.1 169 CDS 100% 4.050 5.670 N Opn3 n/a
4 TRCN0000221334 CCCATCGTGATGTCACAGAAA pLKO.1 743 CDS 100% 4.950 3.960 N Opn3 n/a
5 TRCN0000322403 GCTGGCCTATGAACGTTATAT pLKO_005 100 CDS 100% 15.000 10.500 N Opn3 n/a
6 TRCN0000322406 CTGGAGGGCCATTACCTATAT pLKO_005 160 CDS 100% 13.200 9.240 N Opn3 n/a
7 TRCN0000322405 ACAGGTACATCCTAGACATAC pLKO_005 228 CDS 100% 10.800 7.560 N Opn3 n/a
8 TRCN0000336089 GACAGAAGCAGCGCATCTAAG pLKO_005 857 CDS 100% 10.800 7.560 N Opn3 n/a
9 TRCN0000322408 ATGGAAGACAGAGTCCTATAT pLKO_005 910 3UTR 100% 13.200 7.920 N Opn3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496642.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02806 pDONR223 100% 59.7% 61.9% None (many diffs) n/a
2 ccsbBroad304_02806 pLX_304 0% 59.7% 61.9% V5 (many diffs) n/a
3 TRCN0000468561 TCCACCCTGCGGGAGTGCATTACA pLX_317 32.2% 59.7% 61.9% V5 (many diffs) n/a
4 TRCN0000487981 GCCCATGCGTTCTCACGCCCGATT pLX_317 26.7% 59.7% 61.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV