Transcript: Mouse XM_006496962.2

PREDICTED: Mus musculus aarF domain containing kinase 3 (Adck3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Coq8a (67426)
Length:
2557
CDS:
65..2002

Additional Resources:

NCBI RefSeq record:
XM_006496962.2
NBCI Gene record:
Coq8a (67426)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496962.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088854 CCACTGAAACAGATGACGAAA pLKO.1 977 CDS 100% 4.950 6.930 N Coq8a n/a
2 TRCN0000345145 ATGAAGTTCCTTACCGGTTAT pLKO_005 1685 CDS 100% 10.800 8.640 N Coq8a n/a
3 TRCN0000345146 ATGAGATCTGCTACAACATTT pLKO_005 1449 CDS 100% 13.200 9.240 N Coq8a n/a
4 TRCN0000345208 ATGCTCACCTGGATGCTATTC pLKO_005 1725 CDS 100% 10.800 7.560 N Coq8a n/a
5 TRCN0000345207 GCTGACCACAGAGCTCATATC pLKO_005 1381 CDS 100% 10.800 7.560 N Coq8a n/a
6 TRCN0000088855 GCAGTGCTAAAGAAATCCATA pLKO.1 1661 CDS 100% 4.950 3.465 N Coq8a n/a
7 TRCN0000088856 GCTGTTTGAGTTCCATGTCAT pLKO.1 1489 CDS 100% 4.950 3.465 N Coq8a n/a
8 TRCN0000088857 CAGAGTCAATGGAAGGCTCTT pLKO.1 472 CDS 100% 4.050 2.835 N Coq8a n/a
9 TRCN0000380420 GAAGGTGCAGGGTCAGGATAA pLKO_005 232 CDS 100% 10.800 6.480 N COQ8A n/a
10 TRCN0000021507 GCATCCAGGATGATGCCTTTA pLKO.1 900 CDS 100% 1.080 0.648 N COQ8A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496962.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08681 pDONR223 100% 83.4% 86.5% None (many diffs) n/a
2 ccsbBroad304_08681 pLX_304 0% 83.4% 86.5% V5 (many diffs) n/a
3 TRCN0000480325 CATAAGCAAGGTCTTTGGAAAGTC pLX_317 22.3% 83.4% 86.5% V5 (many diffs) n/a
4 ccsbBroadEn_15116 pDONR223 0% 83.4% 86.5% None (many diffs) n/a
5 ccsbBroad304_15116 pLX_304 0% 83.4% 86.5% V5 (many diffs) n/a
6 TRCN0000480598 CACCATGCATAGCCTTAACACGAA pLX_317 19.3% 83.4% 86.5% V5 (many diffs) n/a
7 TRCN0000489114 GATTAAATTGAGTCTTAGATCCTT pLX_317 12.2% 83.4% 86.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV