Transcript: Mouse XM_006497399.2

PREDICTED: Mus musculus protein kinase C, theta (Prkcq), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prkcq (18761)
Length:
2265
CDS:
297..1691

Additional Resources:

NCBI RefSeq record:
XM_006497399.2
NBCI Gene record:
Prkcq (18761)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497399.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365991 TAATGACATCATCCCGTTATA pLKO_005 1890 3UTR 100% 13.200 18.480 N Prkcq n/a
2 TRCN0000022856 GCGATGATTGAAAGCACCCAA pLKO.1 444 CDS 100% 2.640 3.696 N Prkcq n/a
3 TRCN0000374373 GCCCTTGAAGTTAGATCATTA pLKO_005 1933 3UTR 100% 13.200 10.560 N Prkcq n/a
4 TRCN0000365992 ATCTCAATGGAGGCGACTTAA pLKO_005 946 CDS 100% 13.200 9.240 N Prkcq n/a
5 TRCN0000366064 CCGAGAAGGCCCAGTTGAAAT pLKO_005 500 CDS 100% 13.200 9.240 N Prkcq n/a
6 TRCN0000379017 TGGCATGGGAGCATCCATTTC pLKO_005 868 CDS 100% 10.800 7.560 N Prkcq n/a
7 TRCN0000022855 GCAGAGTTCAAGAGAACCAAT pLKO.1 756 CDS 100% 4.950 3.465 N Prkcq n/a
8 TRCN0000425425 CCCTTTGGATGGGTCAAATAA pLKO_005 611 CDS 100% 15.000 9.000 N Prkcq n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497399.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06774 pDONR223 100% 55.9% 57.8% None (many diffs) n/a
2 ccsbBroad304_06774 pLX_304 0% 55.9% 57.8% V5 (many diffs) n/a
3 TRCN0000481518 AATCGCTGTAAGTTTAGGCCGCAG pLX_317 15.8% 55.9% 57.8% V5 (many diffs) n/a
4 ccsbBroadEn_14795 pDONR223 72.2% 55.9% 1.5% None (many diffs) n/a
5 ccsbBroad304_14795 pLX_304 0% 55.9% 1.5% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000471118 GATCACATAAGTACAGACCTGGCC pLX_317 15.5% 55.9% 1.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV