Transcript: Mouse XM_006497623.3

PREDICTED: Mus musculus activin receptor IIA (Acvr2a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acvr2a (11480)
Length:
4303
CDS:
15..1580

Additional Resources:

NCBI RefSeq record:
XM_006497623.3
NBCI Gene record:
Acvr2a (11480)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497623.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022661 GCTAGAGGATTGGCATATTTA pLKO.1 927 CDS 100% 15.000 21.000 N Acvr2a n/a
2 TRCN0000274494 GCTAGAGGATTGGCATATTTA pLKO_005 927 CDS 100% 15.000 21.000 N Acvr2a n/a
3 TRCN0000285238 GGTGTTGGAGGGTGCTATAAA pLKO_005 1145 CDS 100% 15.000 12.000 N Acvr2a n/a
4 TRCN0000274492 GACCTGGCTAATCAAGTATTT pLKO_005 1868 3UTR 100% 13.200 10.560 N Acvr2a n/a
5 TRCN0000244976 GGCTAGAGGATTGGCATATTT pLKO_005 926 CDS 100% 15.000 10.500 N ACVR2A n/a
6 TRCN0000000556 CAGGAAGTTGTTGTGCATAAA pLKO.1 1323 CDS 100% 13.200 9.240 N ACVR2A n/a
7 TRCN0000022659 GCCCAGTTGCTCAATGAATAT pLKO.1 663 CDS 100% 13.200 9.240 N Acvr2a n/a
8 TRCN0000274495 GCCCAGTTGCTCAATGAATAT pLKO_005 663 CDS 100% 13.200 9.240 N Acvr2a n/a
9 TRCN0000022663 GAGGGCAATATGTGTAATGAA pLKO.1 330 CDS 100% 5.625 3.938 N Acvr2a n/a
10 TRCN0000022662 CCTCCCAAAGAATCTAGTCTA pLKO.1 1557 CDS 100% 4.950 3.465 N Acvr2a n/a
11 TRCN0000000552 CCTTAAATGAACTACTGCTAT pLKO.1 1935 3UTR 100% 4.950 3.465 N ACVR2A n/a
12 TRCN0000000554 GCTAATGTGGTCTCTTGGAAT pLKO.1 879 CDS 100% 4.950 3.465 N ACVR2A n/a
13 TRCN0000022660 CCTGTGGCTAATCACAGCATT pLKO.1 824 CDS 100% 0.495 0.347 N Acvr2a n/a
14 TRCN0000274493 CCTGTGGCTAATCACAGCATT pLKO_005 824 CDS 100% 0.495 0.347 N Acvr2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497623.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05768 pDONR223 100% 93% 98% None (many diffs) n/a
2 ccsbBroad304_05768 pLX_304 0% 93% 98% V5 (many diffs) n/a
3 TRCN0000476792 GCATCAATGGAAATCAAAGACCTG pLX_317 33.3% 93% 98% V5 (many diffs) n/a
4 ccsbBroadEn_14529 pDONR223 0% 93% 98% None (many diffs) n/a
5 ccsbBroad304_14529 pLX_304 0% 93% 98% V5 (many diffs) n/a
6 TRCN0000469988 CAAGCGACGGGCTTTCGGACTAAA pLX_317 25.7% 93% 98% V5 (many diffs) n/a
7 TRCN0000489398 TCACAGGTGCGAGCCCAGATTTCA pLX_317 21.5% 93% 98% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000489291 AGTTCGTTACTAGGGTGTGACGGC pLX_317 23.3% 92.9% 98% V5 (many diffs) n/a
Download CSV