Transcript: Mouse XM_006498930.2

PREDICTED: Mus musculus phospholipase C, beta 1 (Plcb1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plcb1 (18795)
Length:
11910
CDS:
5441..8932

Additional Resources:

NCBI RefSeq record:
XM_006498930.2
NBCI Gene record:
Plcb1 (18795)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498930.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435280 TCTAACCTGGTGAACTATATT pLKO_005 6902 CDS 100% 15.000 21.000 N Plcb1 n/a
2 TRCN0000429550 ATCTGATCCAGAGCGTGTTAA pLKO_005 7968 CDS 100% 13.200 18.480 N Plcb1 n/a
3 TRCN0000428549 GTAATCGAAGCTCTATCAAAC pLKO_005 7697 CDS 100% 10.800 15.120 N Plcb1 n/a
4 TRCN0000218583 AGTGTCAGAACAATCAGTTAA pLKO_005 8424 CDS 100% 13.200 9.240 N PLCB1 n/a
5 TRCN0000426090 AGTGTCAGAACAATCAGTTAA pLKO_005 8424 CDS 100% 13.200 9.240 N Plcb1 n/a
6 TRCN0000076908 CCTCCAGTGAGGAGATAGAAA pLKO.1 8874 CDS 100% 5.625 3.938 N Plcb1 n/a
7 TRCN0000076911 GCTGTCTTTGTCTACATAGAA pLKO.1 7643 CDS 100% 5.625 3.938 N Plcb1 n/a
8 TRCN0000076909 CCCGGCTCAATGAAATCCTTT pLKO.1 6048 CDS 100% 4.950 3.465 N Plcb1 n/a
9 TRCN0000076912 CGCATGATAACTGTGGTGTAT pLKO.1 5582 CDS 100% 4.950 3.465 N Plcb1 n/a
10 TRCN0000076910 GCAGATAAACATGGGCATGTA pLKO.1 7180 CDS 100% 4.950 3.465 N Plcb1 n/a
11 TRCN0000226443 TTCGGCCAGGCTATCACTATA pLKO_005 7581 CDS 100% 13.200 18.480 N PLCB1 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 10683 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498930.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07859 pDONR223 100% 84.6% 92.5% None (many diffs) n/a
2 ccsbBroad304_07859 pLX_304 0% 84.6% 92.5% V5 (many diffs) n/a
3 TRCN0000471930 CGACTGTTATCACCCAATCAACCT pLX_317 12.8% 84.6% 92.5% V5 (many diffs) n/a
4 ccsbBroadEn_15752 pDONR223 0% 80.9% 88% None (many diffs) n/a
5 ccsbBroad304_15752 pLX_304 0% 80.9% 88% V5 (many diffs) n/a
Download CSV