Transcript: Mouse XM_006499057.3

PREDICTED: Mus musculus synaptosomal-associated protein 23 (Snap23), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Snap23 (20619)
Length:
2896
CDS:
350..982

Additional Resources:

NCBI RefSeq record:
XM_006499057.3
NBCI Gene record:
Snap23 (20619)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499057.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110579 GAACAACTAAATCGCATAGAA pLKO.1 497 CDS 100% 5.625 7.875 N Snap23 n/a
2 TRCN0000325516 GAACAACTAAATCGCATAGAA pLKO_005 497 CDS 100% 5.625 7.875 N Snap23 n/a
3 TRCN0000110578 ACCTAGCAATGTAGTATCTAA pLKO.1 679 CDS 100% 5.625 4.500 N Snap23 n/a
4 TRCN0000311443 CAACCGAGCCGGATTACAAAT pLKO_005 701 CDS 100% 13.200 9.240 N Snap23 n/a
5 TRCN0000110575 CGTCTCTTCATCTCTTCATTT pLKO.1 1186 3UTR 100% 13.200 9.240 N Snap23 n/a
6 TRCN0000325517 CGTCTCTTCATCTCTTCATTT pLKO_005 1186 3UTR 100% 13.200 9.240 N Snap23 n/a
7 TRCN0000305934 GTGGATACATTAAACGTATAA pLKO_005 756 CDS 100% 13.200 9.240 N Snap23 n/a
8 TRCN0000110576 CCCTTGTAATAGGACAAAGAA pLKO.1 604 CDS 100% 5.625 3.938 N Snap23 n/a
9 TRCN0000110577 GCCAATACAAGAGCAAAGAAA pLKO.1 947 CDS 100% 5.625 3.938 N Snap23 n/a
10 TRCN0000325590 GCCAATACAAGAGCAAAGAAA pLKO_005 947 CDS 100% 5.625 3.938 N Snap23 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1678 3UTR 100% 4.950 2.475 Y KAAG1 n/a
12 TRCN0000088533 CGGGAGGCAGAGGCAGGCAAT pLKO.1 2490 3UTR 100% 0.000 0.000 Y Trrap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499057.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02013 pDONR223 100% 88.3% 87.2% None (many diffs) n/a
2 ccsbBroad304_02013 pLX_304 0% 88.3% 87.2% V5 (many diffs) n/a
3 TRCN0000470641 TGTAATGATATTTGACCGAATGTC pLX_317 55.8% 88.3% 87.2% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV