Transcript: Mouse XM_006500777.3

PREDICTED: Mus musculus solute carrier family 7 (cationic amino acid transporter, y+ system), member 11 (Slc7a11), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc7a11 (26570)
Length:
8809
CDS:
58..1443

Additional Resources:

NCBI RefSeq record:
XM_006500777.3
NBCI Gene record:
Slc7a11 (26570)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500777.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079427 CCGGAAATCCTCTCTATGATT pLKO.1 988 CDS 100% 5.625 7.875 N Slc7a11 n/a
2 TRCN0000079423 GCAAGCTAATATGCAAGTCAT pLKO.1 1619 3UTR 100% 4.950 6.930 N Slc7a11 n/a
3 TRCN0000324192 GCAAGCTAATATGCAAGTCAT pLKO_005 1619 3UTR 100% 4.950 6.930 N Slc7a11 n/a
4 TRCN0000381330 CTCTTCATCCCGGCACTATTT pLKO_005 1207 CDS 100% 13.200 10.560 N Slc7a11 n/a
5 TRCN0000380712 TGGAGTTATACAGCTAATTAA pLKO_005 558 CDS 100% 15.000 10.500 N Slc7a11 n/a
6 TRCN0000305655 CATTAGCAGTCCCGATCTTTG pLKO_005 881 CDS 100% 10.800 7.560 N Slc7a11 n/a
7 TRCN0000079425 CCCTGCATATTATCTCTTCAT pLKO.1 1317 CDS 100% 4.950 3.465 N Slc7a11 n/a
8 TRCN0000349040 CCAAGTGGTTCAGACGATTAT pLKO_005 1355 CDS 100% 13.200 7.920 N Slc7a11 n/a
9 TRCN0000079424 CCCTGGAGTTATACAGCTAAT pLKO.1 555 CDS 100% 10.800 6.480 N Slc7a11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500777.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02826 pDONR223 100% 79.7% 65.8% None (many diffs) n/a
2 ccsbBroad304_02826 pLX_304 0% 79.7% 65.8% V5 (many diffs) n/a
3 TRCN0000466827 TCCGGAGTGCATATCCTCCCTTAC pLX_317 30.4% 79.7% 65.8% V5 (many diffs) n/a
Download CSV