Transcript: Mouse XM_006501069.2

PREDICTED: Mus musculus lymphoid enhancer binding factor 1 (Lef1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lef1 (16842)
Length:
3574
CDS:
1210..2319

Additional Resources:

NCBI RefSeq record:
XM_006501069.2
NBCI Gene record:
Lef1 (16842)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501069.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000225789 TGGTCAGCGCGAGACAATTAT pLKO_005 2215 CDS 100% 15.000 21.000 N Lef1 n/a
2 TRCN0000360348 GCGACCCGTACATGTCAAATG pLKO_005 1568 CDS 100% 10.800 15.120 N Lef1 n/a
3 TRCN0000225788 GTAGCTGAGTGCACGCTAAAG pLKO_005 2071 CDS 100% 10.800 15.120 N Lef1 n/a
4 TRCN0000225787 TTGGTTAACGAGTCCGAAATC pLKO_005 1372 CDS 100% 10.800 15.120 N Lef1 n/a
5 TRCN0000360417 TGGTGGTAAGAGAAGCTCCTT pLKO_005 2324 3UTR 100% 2.640 3.696 N Lef1 n/a
6 TRCN0000012676 CATATTAAGAAGCCTCTGAAT pLKO.1 2011 CDS 100% 4.950 3.960 N Lef1 n/a
7 TRCN0000012674 GCGAGACAATTATGGCAAGAA pLKO.1 2223 CDS 100% 4.950 3.960 N Lef1 n/a
8 TRCN0000360344 ATCCCGAGGACATCAAATAAA pLKO_005 1606 CDS 100% 15.000 10.500 N Lef1 n/a
9 TRCN0000218932 CAGTTACTCTGGCTACATAAT pLKO_005 1530 CDS 100% 13.200 9.240 N Lef1 n/a
10 TRCN0000012675 CCAGTTACTCTGGCTACATAA pLKO.1 1529 CDS 100% 13.200 9.240 N Lef1 n/a
11 TRCN0000360345 GCCGACATCAAGTCATCTTTG pLKO_005 1354 CDS 100% 10.800 7.560 N Lef1 n/a
12 TRCN0000012677 AGCCGACATCAAGTCATCTTT pLKO.1 1353 CDS 100% 5.625 3.938 N Lef1 n/a
13 TRCN0000225790 AGCTCCTTCCCAACGTGCAAA pLKO_005 2337 3UTR 100% 4.950 3.465 N Lef1 n/a
14 TRCN0000360418 TCTGGAGATGGAAGCTTGTTG pLKO_005 2384 3UTR 100% 4.950 3.465 N Lef1 n/a
15 TRCN0000012673 CCCAAGGAACACTGACAGCAA pLKO.1 2441 3UTR 100% 2.640 1.848 N Lef1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501069.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03237 pDONR223 100% 84.4% 90.4% None (many diffs) n/a
2 ccsbBroad304_03237 pLX_304 0% 84.4% 90.4% V5 (many diffs) n/a
3 TRCN0000471255 AAGTACATCCGCGTCACCGTCCCA pLX_317 17.5% 84.4% 90.4% V5 (many diffs) n/a
Download CSV