Transcript: Mouse XM_006501240.1

PREDICTED: Mus musculus adaptor-related protein complex 1 associated regulatory protein (Ap1ar), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ap1ar (211556)
Length:
2797
CDS:
201..1313

Additional Resources:

NCBI RefSeq record:
XM_006501240.1
NBCI Gene record:
Ap1ar (211556)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501240.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248972 ACAAATTATGTTAGCGTATTG pLKO_005 2206 3UTR 100% 10.800 15.120 N Ap1ar n/a
2 TRCN0000257852 CCTTTCACATGCCATTATATT pLKO_005 1959 3UTR 100% 15.000 10.500 N Ap1ar n/a
3 TRCN0000248969 GCAAGAGATGACAGGATTAAA pLKO_005 1858 3UTR 100% 15.000 10.500 N Ap1ar n/a
4 TRCN0000248971 GGATACTTTGAGTTGGTAATA pLKO_005 1895 3UTR 100% 13.200 9.240 N Ap1ar n/a
5 TRCN0000248970 CGACCTGTGTCTGAGTCTTAG pLKO_005 2228 3UTR 100% 10.800 7.560 N Ap1ar n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1797 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501240.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08533 pDONR223 100% 59.9% 56.6% None (many diffs) n/a
2 ccsbBroad304_08533 pLX_304 0% 59.9% 56.6% V5 (many diffs) n/a
3 TRCN0000466991 CCCTGTGGATACATCTAACCATGC pLX_317 59.3% 59.9% 56.6% V5 (many diffs) n/a
Download CSV