Transcript: Mouse XM_006501612.3

PREDICTED: Mus musculus phosphatidylinositol glycan anchor biosynthesis, class K (Pigk), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pigk (329777)
Length:
3920
CDS:
440..1375

Additional Resources:

NCBI RefSeq record:
XM_006501612.3
NBCI Gene record:
Pigk (329777)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501612.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018421 GCGGTTCTACTCTCCTAACAT pLKO.1 826 CDS 100% 5.625 7.875 N Pigk n/a
2 TRCN0000279225 GCGGTTCTACTCTCCTAACAT pLKO_005 826 CDS 100% 5.625 7.875 N Pigk n/a
3 TRCN0000018423 CCTGCGATTGGAGTTCATCTT pLKO.1 902 CDS 100% 4.950 3.465 N Pigk n/a
4 TRCN0000279223 CCTGCGATTGGAGTTCATCTT pLKO_005 902 CDS 100% 4.950 3.465 N Pigk n/a
5 TRCN0000018424 CCACAAGAACATGGAGCTCAA pLKO.1 499 CDS 100% 4.050 2.835 N Pigk n/a
6 TRCN0000279163 CCACAAGAACATGGAGCTCAA pLKO_005 499 CDS 100% 4.050 2.835 N Pigk n/a
7 TRCN0000018425 CATGGTCTTCTTCAAGACCTA pLKO.1 1324 CDS 100% 0.264 0.185 N Pigk n/a
8 TRCN0000279222 CATGGTCTTCTTCAAGACCTA pLKO_005 1324 CDS 100% 0.264 0.185 N Pigk n/a
9 TRCN0000050119 GCTCAGATAATACACCAGAAA pLKO.1 1241 CDS 100% 4.950 6.435 N PIGK n/a
10 TRCN0000288940 GCTCAGATAATACACCAGAAA pLKO_005 1241 CDS 100% 4.950 6.435 N PIGK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501612.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02295 pDONR223 100% 66.4% 74.1% None (many diffs) n/a
2 ccsbBroad304_02295 pLX_304 0% 66.4% 74.1% V5 (many diffs) n/a
3 TRCN0000474584 CCTTCTCAATAACCGTTGCATTTT pLX_317 46.8% 66.4% 74.1% V5 (many diffs) n/a
4 ccsbBroadEn_11448 pDONR223 100% 53% 59.4% None (many diffs) n/a
5 ccsbBroad304_11448 pLX_304 0% 53% 59.4% V5 (many diffs) n/a
6 TRCN0000468670 GCAATACCGTGGGACACTGAGCCT pLX_317 31.7% 53% 59.4% V5 (many diffs) n/a
Download CSV