Transcript: Mouse XM_006501748.1

PREDICTED: Mus musculus PDZ and LIM domain 5 (Pdlim5), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pdlim5 (56376)
Length:
4709
CDS:
148..1614

Additional Resources:

NCBI RefSeq record:
XM_006501748.1
NBCI Gene record:
Pdlim5 (56376)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501748.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304756 ACGACTCAGTCTCGTTCTTTC pLKO_005 667 CDS 100% 10.800 15.120 N Pdlim5 n/a
2 TRCN0000088642 AGGGTGACATTAAGCAGCAAA pLKO.1 506 CDS 100% 4.950 3.465 N Pdlim5 n/a
3 TRCN0000088638 CCCAGAACAAGATTAAGGCTT pLKO.1 344 CDS 100% 2.640 1.848 N Pdlim5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501748.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07648 pDONR223 100% 68.7% 72.2% None (many diffs) n/a
2 ccsbBroad304_07648 pLX_304 0% 68.7% 72.2% V5 (many diffs) n/a
3 TRCN0000480419 AGTGTAATCATCCGAGAGCCTTTT pLX_317 24.1% 68.7% 72.2% V5 (many diffs) n/a
Download CSV