Transcript: Mouse XM_006502073.2

PREDICTED: Mus musculus doublecortin-like kinase 2 (Dclk2), transcript variant X12, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dclk2 (70762)
Length:
3921
CDS:
603..2660

Additional Resources:

NCBI RefSeq record:
XM_006502073.2
NBCI Gene record:
Dclk2 (70762)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502073.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361787 CGGCAACTTCGCGGTAGTTAA pLKO_005 1853 CDS 100% 13.200 18.480 N Dclk2 n/a
2 TRCN0000361788 GAAATGCATTGGACGAATTAG pLKO_005 3221 3UTR 100% 13.200 18.480 N Dclk2 n/a
3 TRCN0000024268 CCTCCAACGAACCATTTCGTA pLKO.1 1042 CDS 100% 0.300 0.420 N Dclk2 n/a
4 TRCN0000024266 GCCAAGGAGTTAATCAGTCAA pLKO.1 2517 CDS 100% 4.950 3.960 N Dclk2 n/a
5 TRCN0000361789 AGACTCTGCCAAGGAGTTAAT pLKO_005 2510 CDS 100% 13.200 9.240 N Dclk2 n/a
6 TRCN0000361848 GAGCCTCAGCTGCGAAGTATT pLKO_005 1489 CDS 100% 13.200 9.240 N Dclk2 n/a
7 TRCN0000356265 TGACTTTGTCCTGGATCATAG pLKO_005 1436 CDS 100% 10.800 7.560 N DCLK2 n/a
8 TRCN0000024265 GCTGGTGTGATTACATACATA pLKO.1 2376 CDS 100% 5.625 3.938 N Dclk2 n/a
9 TRCN0000024264 CCCAAGTTAGTGACTGTGATT pLKO.1 1185 CDS 100% 4.950 3.465 N Dclk2 n/a
10 TRCN0000001972 TCAGTCAAATGCTTCAGGTAA pLKO.1 2530 CDS 100% 4.950 3.465 N DCLK2 n/a
11 TRCN0000350418 AGTCAAATGCTTCAGGTAAAT pLKO_005 2532 CDS 100% 13.200 9.240 N DCLK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502073.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15276 pDONR223 0% 84.1% 90.1% None (many diffs) n/a
2 ccsbBroad304_15276 pLX_304 0% 84.1% 90.1% V5 (many diffs) n/a
3 ccsbBroadEn_14422 pDONR223 100% 84% .4% None (many diffs) n/a
4 ccsbBroad304_14422 pLX_304 0% 84% .4% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000475901 AACTGCGCTTGTTTCCCTCCGCCA pLX_317 14.8% 84% .4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV