Transcript: Mouse XM_006502083.3

PREDICTED: Mus musculus purinergic receptor P2Y, G-protein coupled 12 (P2ry12), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
P2ry12 (70839)
Length:
2498
CDS:
605..1648

Additional Resources:

NCBI RefSeq record:
XM_006502083.3
NBCI Gene record:
P2ry12 (70839)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502083.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028692 GCACGAAATAGTCAATTACAT pLKO.1 1180 CDS 100% 5.625 7.875 N P2ry12 n/a
2 TRCN0000329060 GCACGAAATAGTCAATTACAT pLKO_005 1180 CDS 100% 5.625 7.875 N P2ry12 n/a
3 TRCN0000329062 ATGGATAAGGCCTGGATTATT pLKO_005 2096 3UTR 100% 15.000 12.000 N P2ry12 n/a
4 TRCN0000028708 CCGCAGTAAATCCAACTTCAT pLKO.1 781 CDS 100% 4.950 3.960 N P2ry12 n/a
5 TRCN0000329061 GGTCATCTCTGATCTACTAAT pLKO_005 820 CDS 100% 13.200 9.240 N P2ry12 n/a
6 TRCN0000329063 TTCTTTCAGATCCGCAGTAAA pLKO_005 770 CDS 100% 13.200 9.240 N P2ry12 n/a
7 TRCN0000028714 CGGTCATCTCTGATCTACTAA pLKO.1 819 CDS 100% 5.625 3.938 N P2ry12 n/a
8 TRCN0000028736 GCCAAGTTACTTCAGTCACAT pLKO.1 912 CDS 100% 4.950 3.465 N P2ry12 n/a
9 TRCN0000329059 GCCAAGTTACTTCAGTCACAT pLKO_005 912 CDS 100% 4.950 3.465 N P2ry12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502083.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491982 AGATGAAATCGAAGTGTCCGTAAC pLX_317 41.1% 82.2% 86.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_08873 pDONR223 100% 82.1% 86.2% None (many diffs) n/a
3 ccsbBroad304_08873 pLX_304 0% 82.1% 86.2% V5 (many diffs) n/a
4 TRCN0000470996 GACGGTAAGCCAATCCCTTTATGG pLX_317 43.9% 82.1% 86.2% V5 (many diffs) n/a
5 TRCN0000487732 GTACTTCCTAGACCAAGAACGTAT pLX_317 24.2% 82% 85.9% V5 (many diffs) n/a
Download CSV