Transcript: Mouse XM_006503406.3

PREDICTED: Mus musculus splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated) (Sfpq), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sfpq (71514)
Length:
3321
CDS:
591..2843

Additional Resources:

NCBI RefSeq record:
XM_006503406.3
NBCI Gene record:
Sfpq (71514)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503406.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001082 GCCCAGAAGAATCCAATGTAT pLKO.1 2223 CDS 100% 5.625 4.500 N SFPQ n/a
2 TRCN0000349629 GCCCAGAAGAATCCAATGTAT pLKO_005 2223 CDS 100% 5.625 4.500 N SFPQ n/a
3 TRCN0000102243 CCAGGAAGAATTAAGGCGCAT pLKO.1 2459 CDS 100% 2.160 1.728 N Sfpq n/a
4 TRCN0000102242 GCCAGTTTGGTCCTATTGAAA pLKO.1 2008 CDS 100% 5.625 3.938 N Sfpq n/a
5 TRCN0000102241 CCAGTCATTGTGGAACCACTT pLKO.1 2163 CDS 100% 4.050 2.835 N Sfpq n/a
6 TRCN0000102244 AGAAGAAAGTTACAGCAGGAT pLKO.1 2612 CDS 100% 2.640 1.584 N Sfpq n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503406.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06934 pDONR223 100% 72.8% 77.6% None (many diffs) n/a
2 ccsbBroad304_06934 pLX_304 0% 72.8% 77.6% V5 (many diffs) n/a
3 TRCN0000476555 ATCAGGAGGGATTTCTCCAGACCT pLX_317 17.1% 72.8% 77.6% V5 (many diffs) n/a
Download CSV