Transcript: Mouse XM_006504086.3

PREDICTED: Mus musculus small integral membrane protein 14 (Smim14), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smim14 (68552)
Length:
5466
CDS:
1606..1905

Additional Resources:

NCBI RefSeq record:
XM_006504086.3
NBCI Gene record:
Smim14 (68552)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504086.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265038 TTCTGAGGCCTCCTAACCTGA pLKO_005 1811 CDS 100% 2.640 3.696 N Smim14 n/a
2 TRCN0000377047 CACGAACATGCTATGAGGAGG pLKO_005 1648 CDS 100% 2.160 3.024 N Smim14 n/a
3 TRCN0000377049 AGTCCTACTGCACCGACACAG pLKO_005 1694 CDS 100% 1.350 1.890 N Smim14 n/a
4 TRCN0000174635 GCAGTTTGGATGGTATTGTTT pLKO.1 1996 3UTR 100% 5.625 4.500 N Smim14 n/a
5 TRCN0000173514 GCTCTCACGAACATGCTATGA pLKO.1 1643 CDS 100% 4.950 3.960 N Smim14 n/a
6 TRCN0000265037 ACTAACGTCCTGGTGTGGGAA pLKO_005 1901 CDS 100% 2.640 2.112 N Smim14 n/a
7 TRCN0000265035 AGTTGCCACCGTCCTTATTTA pLKO_005 2064 3UTR 100% 15.000 10.500 N Smim14 n/a
8 TRCN0000377050 TGTTGGTTGGCCTAAGCTTAA pLKO_005 2128 3UTR 100% 10.800 7.560 N Smim14 n/a
9 TRCN0000174401 CACCGTCCTTATTTACAGTAT pLKO.1 2070 3UTR 100% 4.950 3.465 N Smim14 n/a
10 TRCN0000265034 GTGTCTGCTCTCACGAACATG pLKO_005 1637 CDS 100% 4.950 3.465 N Smim14 n/a
11 TRCN0000265036 TGAGGAGGCTCATCAATCTGC pLKO_005 1661 CDS 100% 2.640 1.848 N Smim14 n/a
12 TRCN0000377048 ATGCTCCTCTTCCTTCTGAGG pLKO_005 1798 CDS 100% 2.160 1.512 N Smim14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504086.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05200 pDONR223 100% 82.4% 89.8% None (many diffs) n/a
2 ccsbBroad304_05200 pLX_304 0% 82.4% 89.8% V5 (many diffs) n/a
3 TRCN0000474064 GTGATTTTAAACTCCCGATAAACT pLX_317 100% 82.4% 89.8% V5 (many diffs) n/a
Download CSV