Transcript: Mouse XM_006504262.3

PREDICTED: Mus musculus platelet derived growth factor receptor, alpha polypeptide (Pdgfra), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pdgfra (18595)
Length:
6554
CDS:
174..3443

Additional Resources:

NCBI RefSeq record:
XM_006504262.3
NBCI Gene record:
Pdgfra (18595)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504262.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321928 GATGATCTGCAAGCATATTAA pLKO_005 1514 CDS 100% 15.000 21.000 N Pdgfra n/a
2 TRCN0000055007 GCCAGCAATGTCTCAAATATT pLKO.1 1569 CDS 100% 15.000 21.000 N Pdgfra n/a
3 TRCN0000322002 CGTTCAAGACCAGCGAGTTTA pLKO_005 763 CDS 100% 13.200 10.560 N Pdgfra n/a
4 TRCN0000055006 CGATTCCAACTACGTGTCAAA pLKO.1 2708 CDS 100% 4.950 3.960 N Pdgfra n/a
5 TRCN0000055003 GCCAGCTCTTATTACCCTCTA pLKO.1 241 CDS 100% 4.050 3.240 N Pdgfra n/a
6 TRCN0000321999 AGTGGCCATTACACCATTATA pLKO_005 1338 CDS 100% 15.000 10.500 N Pdgfra n/a
7 TRCN0000321927 GGATACTTGGATTGAACTTTA pLKO_005 3602 3UTR 100% 13.200 9.240 N Pdgfra n/a
8 TRCN0000350662 TCATCGTCCTGGTGGTCATTT pLKO_005 1798 CDS 100% 13.200 9.240 N Pdgfra n/a
9 TRCN0000055005 CCTGGAGAAGTGAGAAACAAA pLKO.1 921 CDS 100% 5.625 3.938 N Pdgfra n/a
10 TRCN0000055004 GCCACATTTGAACATTGTGAA pLKO.1 2129 CDS 100% 4.950 2.970 N Pdgfra n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504262.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14734 pDONR223 0% 86.4% 91.8% None (many diffs) n/a
2 ccsbBroad304_14734 pLX_304 0% 86.4% 91.8% V5 (many diffs) n/a
3 TRCN0000472927 CCCTCGTGGCCGGGGGTTCCCTGT pLX_317 13.3% 86.4% 91.8% V5 (many diffs) n/a
4 TRCN0000491475 TCTACTAACGTTGCATTAGTGGAT pLX_317 10.3% 86.4% 91.8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489486 AGACCGCATTTGGTGACAGGGCCA pLX_317 20.7% 42.8% .6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV