Transcript: Mouse XM_006504318.1

PREDICTED: Mus musculus piwi-like RNA-mediated gene silencing 1 (Piwil1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Piwil1 (57749)
Length:
3886
CDS:
133..2721

Additional Resources:

NCBI RefSeq record:
XM_006504318.1
NBCI Gene record:
Piwil1 (57749)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504318.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009643 CGTTTGATTACAACCCACAAT pLKO.1 1538 CDS 100% 4.950 6.930 N Piwil1 n/a
2 TRCN0000009644 GCGCAATGATTTCAATGTGAT pLKO.1 1323 CDS 100% 4.950 3.960 N Piwil1 n/a
3 TRCN0000415496 AGACTTCATGTTCAATCTATA pLKO_005 975 CDS 100% 13.200 9.240 N Piwil1 n/a
4 TRCN0000424530 ATAACTGGCTGCTGATCTATA pLKO_005 1616 CDS 100% 13.200 9.240 N Piwil1 n/a
5 TRCN0000009645 GCACAAGGTCACAGAAGTATT pLKO.1 660 CDS 100% 13.200 9.240 N Piwil1 n/a
6 TRCN0000420728 TGAAGACCCTGGTCAATTATG pLKO_005 2261 CDS 100% 13.200 9.240 N Piwil1 n/a
7 TRCN0000009642 CCACAGATAGACTTTCCTAAA pLKO.1 2966 3UTR 100% 10.800 7.560 N Piwil1 n/a
8 TRCN0000011810 CCTGCAGATGAACTGCAAGAT pLKO.1 1950 CDS 100% 0.495 0.297 N Piwil1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504318.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07384 pDONR223 100% 82% 94.7% None (many diffs) n/a
2 ccsbBroad304_07384 pLX_304 0% 82% 94.7% V5 (many diffs) n/a
3 TRCN0000478305 CGCGCGAGCACGAGATCGCAAACA pLX_317 12.3% 82% 94.7% V5 (many diffs) n/a
Download CSV