Transcript: Mouse XM_006504693.3

PREDICTED: Mus musculus F-box and leucine-rich repeat protein 18 (Fbxl18), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fbxl18 (231863)
Length:
3016
CDS:
124..2439

Additional Resources:

NCBI RefSeq record:
XM_006504693.3
NBCI Gene record:
Fbxl18 (231863)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504693.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190159 CGATGAGATCCTCCTACACAT pLKO.1 378 CDS 100% 4.950 3.960 N Fbxl18 n/a
2 TRCN0000201342 GAGTACAGTGACAAGAAGTAA pLKO.1 2637 3UTR 100% 5.625 3.938 N Fbxl18 n/a
3 TRCN0000191870 GAAATTCAACAATCCCTTCTA pLKO.1 1215 CDS 100% 4.950 3.465 N Fbxl18 n/a
4 TRCN0000156770 GTTCTGGTCTCTGCTGAAGAA pLKO.1 1704 CDS 100% 4.950 3.465 N FBXL18 n/a
5 TRCN0000189925 GAAGGTGAAGCAACTGGTGAA pLKO.1 531 CDS 100% 4.050 2.835 N Fbxl18 n/a
6 TRCN0000190757 GATTCTCTCTGTCACTCTCAT pLKO.1 2616 3UTR 100% 4.950 2.970 N Fbxl18 n/a
7 TRCN0000189968 GTCACATGTTCACCGGAGAAT pLKO.1 2219 CDS 100% 4.950 2.970 N Fbxl18 n/a
8 TRCN0000156286 CTGCTGCTCTACTTCGAGATT pLKO.1 871 CDS 100% 4.950 2.970 N FBXL18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504693.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14279 pDONR223 100% 39.8% 42.3% None (many diffs) n/a
2 ccsbBroad304_14279 pLX_304 0% 39.8% 42.3% V5 (many diffs) n/a
3 ccsbBroadEn_12664 pDONR223 100% 29.2% 10.1% None (many diffs) n/a
4 ccsbBroad304_12664 pLX_304 0% 29.2% 10.1% V5 (many diffs) n/a
Download CSV