Transcript: Mouse XM_006505030.2

PREDICTED: Mus musculus CAS1 domain containing 1 (Casd1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Casd1 (213819)
Length:
3844
CDS:
184..2607

Additional Resources:

NCBI RefSeq record:
XM_006505030.2
NBCI Gene record:
Casd1 (213819)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505030.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413247 TTATCCATTATTGGGTATTTC pLKO_005 1177 CDS 100% 13.200 18.480 N Casd1 n/a
2 TRCN0000121045 GCGCAGGTCGTTATTCCTAAA pLKO.1 2491 CDS 100% 10.800 15.120 N Casd1 n/a
3 TRCN0000121042 GCCTAAATCTTTGGACACTTT pLKO.1 3188 3UTR 100% 4.950 6.930 N Casd1 n/a
4 TRCN0000414586 AGATTCCAGGATCCGTCAATT pLKO_005 873 CDS 100% 13.200 10.560 N Casd1 n/a
5 TRCN0000121044 CGTGTGGTTCATGGTCATATA pLKO.1 1779 CDS 100% 13.200 9.240 N Casd1 n/a
6 TRCN0000412367 TAGAGTGTGTCAGGTCTTATT pLKO_005 1677 CDS 100% 13.200 9.240 N Casd1 n/a
7 TRCN0000035665 CGAGGCAATGATTCGTGTGAA pLKO.1 727 CDS 100% 4.950 3.465 N CASD1 n/a
8 TRCN0000121046 CTGCATCAGTTAAAGTGGATT pLKO.1 977 CDS 100% 4.950 3.465 N Casd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505030.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08879 pDONR223 100% 64.4% 67.5% None (many diffs) n/a
2 ccsbBroad304_08879 pLX_304 0% 64.4% 67.5% V5 (many diffs) n/a
3 TRCN0000477946 TTTTGACAAAGTAGCTATTCAATA pLX_317 12.1% 64.4% 67.5% V5 (many diffs) n/a
Download CSV