Transcript: Mouse XM_006505106.4

PREDICTED: Mus musculus smoothened, frizzled class receptor (Smo), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Smo (319757)
Length:
4547
CDS:
1493..3472

Additional Resources:

NCBI RefSeq record:
XM_006505106.4
NBCI Gene record:
Smo (319757)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505106.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026245 CTCGGGCAAGACATCCTATTT pLKO.1 2161 CDS 100% 13.200 18.480 N Smo n/a
2 TRCN0000026274 CCCTACATTCACATCTCAGTT pLKO.1 4053 3UTR 100% 4.950 3.960 N Smo n/a
3 TRCN0000345431 CCCTACATTCACATCTCAGTT pLKO_005 4053 3UTR 100% 4.950 3.960 N Smo n/a
4 TRCN0000014367 CCTGACTGTGAGATCAAGAAT pLKO.1 2615 CDS 100% 5.625 3.938 N SMO n/a
5 TRCN0000026295 CCTGCGGTTATTCTCTTCTAT pLKO.1 1889 CDS 100% 5.625 3.938 N Smo n/a
6 TRCN0000345493 CCTGCGGTTATTCTCTTCTAT pLKO_005 1889 CDS 100% 5.625 3.938 N Smo n/a
7 TRCN0000026312 GATCCATTCATTCCCGCACTA pLKO.1 3408 CDS 100% 4.050 2.835 N Smo n/a
8 TRCN0000345430 GATCCATTCATTCCCGCACTA pLKO_005 3408 CDS 100% 4.050 2.835 N Smo n/a
9 TRCN0000026288 CAAGAGAATCAAGAAGAGCAA pLKO.1 2782 CDS 100% 2.640 1.848 N Smo n/a
10 TRCN0000345429 CAAGAGAATCAAGAAGAGCAA pLKO_005 2782 CDS 100% 2.640 1.848 N Smo n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4171 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505106.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487980 GTCACACCAAAATTATTAAGGAAA pLX_317 10.9% 75% 79% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488659 CTGGCCATTTTTGGCTGTGATGTG pLX_317 10.8% 75% 78.9% V5 (many diffs) n/a
Download CSV