Transcript: Mouse XM_006505170.3

PREDICTED: Mus musculus transmembrane protein 209 (Tmem209), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem209 (72649)
Length:
3610
CDS:
19..1701

Additional Resources:

NCBI RefSeq record:
XM_006505170.3
NBCI Gene record:
Tmem209 (72649)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505170.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336022 TGCGCACCTCTTCTGACATAA pLKO_005 1777 3UTR 100% 13.200 18.480 N Tmem209 n/a
2 TRCN0000195764 CAGCGGCATGTCTACAATCTT pLKO.1 1546 CDS 100% 5.625 7.875 N Tmem209 n/a
3 TRCN0000336084 CAGCGGCATGTCTACAATCTT pLKO_005 1546 CDS 100% 5.625 7.875 N Tmem209 n/a
4 TRCN0000179959 CCATGGCTGGAATGATATATA pLKO.1 128 CDS 100% 15.000 10.500 N Tmem209 n/a
5 TRCN0000353300 CCATGGCTGGAATGATATATA pLKO_005 128 CDS 100% 15.000 10.500 N Tmem209 n/a
6 TRCN0000183287 GCTGGAATGATATATACTGAA pLKO.1 133 CDS 100% 4.950 3.465 N Tmem209 n/a
7 TRCN0000180605 GCCGATCTCATTTCTAAGCAA pLKO.1 934 CDS 100% 3.000 2.100 N Tmem209 n/a
8 TRCN0000336083 GCCGATCTCATTTCTAAGCAA pLKO_005 934 CDS 100% 3.000 2.100 N Tmem209 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505170.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12883 pDONR223 100% 82.1% 87.7% None (many diffs) n/a
2 ccsbBroad304_12883 pLX_304 0% 82.1% 87.7% V5 (many diffs) n/a
3 TRCN0000479999 TGCCCGCCCAAAGGTGGAGGATCC pLX_317 27.9% 82.1% 87.7% V5 (many diffs) n/a
Download CSV