Transcript: Mouse XM_006506136.2

PREDICTED: Mus musculus cholinergic receptor, muscarinic 2, cardiac (Chrm2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chrm2 (243764)
Length:
5536
CDS:
108..1508

Additional Resources:

NCBI RefSeq record:
XM_006506136.2
NBCI Gene record:
Chrm2 (243764)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506136.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027457 CGTTATGAATCTTCTCATCAT pLKO.1 437 CDS 100% 4.950 3.960 N Chrm2 n/a
2 TRCN0000027455 GTGACCATCATTGGGAACATT pLKO.1 213 CDS 100% 5.625 3.938 N Chrm2 n/a
3 TRCN0000027434 CGAGTCTAGTGCAAGGAAGAA pLKO.1 805 CDS 100% 4.950 3.465 N Chrm2 n/a
4 TRCN0000027422 CAGAACATTGTAGCCCGCAAA pLKO.1 1179 CDS 100% 4.050 2.835 N Chrm2 n/a
5 TRCN0000027480 CCACCTTCAGACTGTCAACAA pLKO.1 263 CDS 100% 4.950 2.970 N Chrm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506136.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00304 pDONR223 100% 89.3% 96.3% None (many diffs) n/a
2 ccsbBroad304_00304 pLX_304 0% 89.3% 96.3% V5 (many diffs) n/a
3 TRCN0000468539 ACAGCACGTGTAGCGCAGTGAGGG pLX_317 28.4% 89.3% 96.3% V5 (many diffs) n/a
4 TRCN0000492171 GCCTTCATTTAGCGTCAGACGATG pLX_317 30.2% 89.3% 96.3% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000492120 CCAATGTGTACTTTACACTCATTA pLX_317 26.2% 89.2% 96.1% V5 (many diffs) n/a
Download CSV