Transcript: Mouse XM_006507012.1

PREDICTED: Mus musculus ethanolamine kinase 1 (Etnk1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Etnk1 (75320)
Length:
1385
CDS:
616..1320

Additional Resources:

NCBI RefSeq record:
XM_006507012.1
NBCI Gene record:
Etnk1 (75320)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507012.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024555 CGGCAACAAGACTGAACTGTT pLKO.1 855 CDS 100% 4.950 6.930 N Etnk1 n/a
2 TRCN0000024558 CGACCTGTTGTGTAAGAATAT pLKO.1 1275 CDS 100% 13.200 9.240 N Etnk1 n/a
3 TRCN0000321659 CGACCTGTTGTGTAAGAATAT pLKO_005 1275 CDS 100% 13.200 9.240 N Etnk1 n/a
4 TRCN0000321660 ATGCTATTCATGCGCACAATG pLKO_005 1061 CDS 100% 10.800 7.560 N Etnk1 n/a
5 TRCN0000024554 CCACCGGATTTGCTGATGAAA pLKO.1 1139 CDS 100% 5.625 3.938 N Etnk1 n/a
6 TRCN0000024556 CCCAAATCTAACCTATGGCTA pLKO.1 1090 CDS 100% 2.640 1.848 N Etnk1 n/a
7 TRCN0000010243 CCAATTACATCCACGTCCCTC pLKO.1 620 CDS 100% 2.160 3.024 N ETNK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507012.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03591 pDONR223 100% 45.4% 48.6% None (many diffs) n/a
2 ccsbBroad304_03591 pLX_304 0% 45.4% 48.6% V5 (many diffs) n/a
3 TRCN0000467028 CGACTAAGAACAGAGCAATGAGGG pLX_317 31.6% 45.4% 48.6% V5 (many diffs) n/a
4 ccsbBroadEn_15099 pDONR223 0% 45.4% 48.6% None (many diffs) n/a
5 ccsbBroad304_15099 pLX_304 0% 45.4% 48.6% V5 (many diffs) n/a
6 TRCN0000470683 TTCTCTCAGCTAGTTGTATTGAAT pLX_317 33.3% 45.4% 48.6% V5 (many diffs) n/a
Download CSV