Transcript: Mouse XM_006507281.3

PREDICTED: Mus musculus cholecystokinin B receptor (Cckbr), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cckbr (12426)
Length:
2385
CDS:
662..1468

Additional Resources:

NCBI RefSeq record:
XM_006507281.3
NBCI Gene record:
Cckbr (12426)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507281.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221819 CCAGTGAACGTGTCCAACAAA pLKO.1 735 CDS 100% 5.625 7.875 N Cckbr n/a
2 TRCN0000271772 CTCACCAGACCACATCATAAA pLKO_005 2027 3UTR 100% 13.200 9.240 N Cckbr n/a
3 TRCN0000221821 CTCCGCTTTGATGGTGATAAT pLKO.1 851 CDS 100% 13.200 9.240 N Cckbr n/a
4 TRCN0000328362 TCCGCTTTGATGGTGATAATG pLKO_005 852 CDS 100% 13.200 9.240 N Cckbr n/a
5 TRCN0000271748 CTCTGTCCAGGCTAAGCTATA pLKO_005 1419 CDS 100% 10.800 7.560 N Cckbr n/a
6 TRCN0000328476 GACCATTCGAATCACCCTTTA pLKO_005 264 5UTR 100% 10.800 7.560 N Cckbr n/a
7 TRCN0000221818 CCCATTACATAGACAGACATA pLKO.1 1703 3UTR 100% 4.950 3.465 N Cckbr n/a
8 TRCN0000221820 CCCTATCTCTTTCATCCACTT pLKO.1 1234 CDS 100% 4.050 2.835 N Cckbr n/a
9 TRCN0000221822 GCGGTGATCTTTCTGATGAGT pLKO.1 286 5UTR 100% 3.000 2.100 N Cckbr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507281.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05945 pDONR223 100% 48.3% 50.3% None (many diffs) n/a
2 ccsbBroad304_05945 pLX_304 0% 48.3% 50.3% V5 (many diffs) n/a
3 TRCN0000467911 ACTGGCAAGCTCCACCCTGCATCA pLX_317 21.8% 48.3% 50.3% V5 (many diffs) n/a
4 TRCN0000489736 CATATCTTAGGAAGGAATTCTCAA pLX_317 30.3% 48.2% 50.3% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489791 GGGGCTCAAACATGTTCATGTGAC pLX_317 28.8% 48.2% 50.2% V5 (many diffs) n/a
Download CSV