Transcript: Mouse XM_006507749.2

PREDICTED: Mus musculus ring finger protein 40 (Rnf40), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnf40 (233900)
Length:
4175
CDS:
182..3220

Additional Resources:

NCBI RefSeq record:
XM_006507749.2
NBCI Gene record:
Rnf40 (233900)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507749.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041048 CGAGAAGTACAGGCTGAGATT pLKO.1 1739 CDS 100% 4.950 3.465 N Rnf40 n/a
2 TRCN0000041050 GCGCATCGAGTTTGAACAGAA pLKO.1 1600 CDS 100% 4.950 3.465 N Rnf40 n/a
3 TRCN0000041051 GACCACTCTAATCGAACCCAT pLKO.1 268 CDS 100% 2.640 1.848 N Rnf40 n/a
4 TRCN0000041052 CCCAAGTGCAACGCAGCCTTT pLKO.1 3164 CDS 100% 1.350 0.945 N Rnf40 n/a
5 TRCN0000041049 GCGAGAACAGAAGCTCAATAA pLKO.1 1087 CDS 100% 13.200 7.920 N Rnf40 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507749.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02248 pDONR223 100% 86.2% 91.5% None (many diffs) n/a
2 ccsbBroad304_02248 pLX_304 0% 86.2% 91.5% V5 (many diffs) n/a
3 TRCN0000469337 CCATCATAGAGAAAGGCATTTGCG pLX_317 2.5% 86.2% 91.5% V5 (many diffs) n/a
Download CSV