Transcript: Mouse XM_006507943.3

PREDICTED: Mus musculus RIC3 acetylcholine receptor chaperone (Ric3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ric3 (320360)
Length:
5078
CDS:
276..902

Additional Resources:

NCBI RefSeq record:
XM_006507943.3
NBCI Gene record:
Ric3 (320360)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507943.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217060 CTGACCAAGAGAAACGATTAC pLKO.1 337 CDS 100% 10.800 15.120 N Ric3 n/a
2 TRCN0000247494 CTGACCAAGAGAAACGATTAC pLKO_005 337 CDS 100% 10.800 15.120 N Ric3 n/a
3 TRCN0000247495 ACAGGAAGATTACCAACTTTG pLKO_005 211 5UTR 100% 10.800 7.560 N Ric3 n/a
4 TRCN0000257795 GACTGATGGGCCAGATCATTC pLKO_005 18 5UTR 100% 10.800 7.560 N Ric3 n/a
5 TRCN0000247493 TCAACAGAGTTGGACCTAATG pLKO_005 289 CDS 100% 10.800 7.560 N Ric3 n/a
6 TRCN0000191629 GAGCTTGTTCAACTACAAGAA pLKO.1 231 5UTR 100% 0.495 0.347 N Ric3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507943.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489052 ACCCTCTTGCATGCCTGCACGGGG pLX_317 32.6% 49% 46.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_08936 pDONR223 100% 48.9% 46.6% None (many diffs) n/a
3 ccsbBroad304_08936 pLX_304 0% 48.9% 46.6% V5 (many diffs) n/a
4 TRCN0000469413 AAACCCGTTCCAAACCATGTGTCA pLX_317 39.7% 48.9% 46.6% V5 (many diffs) n/a
5 TRCN0000488694 TTCTCCCTGACTACGATACCCGTC pLX_317 32.7% 48.9% 23.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV