Transcript: Mouse XM_006508021.3

PREDICTED: Mus musculus mitochondrial ribosomal protein L48 (Mrpl48), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mrpl48 (52443)
Length:
1005
CDS:
473..814

Additional Resources:

NCBI RefSeq record:
XM_006508021.3
NBCI Gene record:
Mrpl48 (52443)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508021.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190951 CATCGGAAGATACAGACACTT pLKO.1 340 5UTR 100% 4.950 3.465 N Mrpl48 n/a
2 TRCN0000319805 CATCGGAAGATACAGACACTT pLKO_005 340 5UTR 100% 4.950 3.465 N Mrpl48 n/a
3 TRCN0000190590 GCAGAAAGTTATGCCCAGTAT pLKO.1 482 CDS 100% 4.950 3.465 N Mrpl48 n/a
4 TRCN0000319821 GCAGAAAGTTATGCCCAGTAT pLKO_005 482 CDS 100% 4.950 3.465 N Mrpl48 n/a
5 TRCN0000189747 GCAATCTTCCAGAAGGAGTCA pLKO.1 702 CDS 100% 2.640 1.848 N Mrpl48 n/a
6 TRCN0000350193 GCAATCTTCCAGAAGGAGTCA pLKO_005 702 CDS 100% 2.640 1.848 N Mrpl48 n/a
7 TRCN0000202082 CACTACAAGACAAAGCCCACT pLKO.1 314 5UTR 100% 2.160 1.512 N Mrpl48 n/a
8 TRCN0000319871 CACTACAAGACAAAGCCCACT pLKO_005 314 5UTR 100% 2.160 1.512 N Mrpl48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508021.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08333 pDONR223 100% 46% 45.7% None (many diffs) n/a
2 ccsbBroad304_08333 pLX_304 0% 46% 45.7% V5 (many diffs) n/a
3 TRCN0000470218 ACGCCGTTTGAACGGCTAGCTGTA pLX_317 77.5% 46% 45.7% V5 (many diffs) n/a
Download CSV