Transcript: Mouse XM_006508236.3

PREDICTED: Mus musculus LYR motif containing 1 (Lyrm1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lyrm1 (73919)
Length:
1221
CDS:
354..722

Additional Resources:

NCBI RefSeq record:
XM_006508236.3
NBCI Gene record:
Lyrm1 (73919)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508236.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200206 CGGATGCAAAGGGATTAGCTA pLKO.1 1026 3UTR 100% 3.000 4.200 N Lyrm1 n/a
2 TRCN0000182680 GACTGCATTACCAGATCCCTT pLKO.1 574 CDS 100% 2.640 3.696 N Lyrm1 n/a
3 TRCN0000182626 GATGGAAGACACCATCGAAGA pLKO.1 440 CDS 100% 0.405 0.567 N Lyrm1 n/a
4 TRCN0000198170 CCAAACCAGTGTATCTGAAGT pLKO.1 682 CDS 100% 4.950 3.465 N Lyrm1 n/a
5 TRCN0000177319 GAGCTGATTAAACAATGCATA pLKO.1 525 CDS 100% 4.950 3.465 N Lyrm1 n/a
6 TRCN0000182370 GCAAGTTCACATGGCTCCAAA pLKO.1 1053 3UTR 100% 4.950 3.465 N Lyrm1 n/a
7 TRCN0000064099 GCAGATGGAAGACACCATCAA pLKO.1 437 CDS 100% 0.495 0.347 N LYRM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508236.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08710 pDONR223 100% 87.1% 86.8% None (many diffs) n/a
2 ccsbBroad304_08710 pLX_304 0% 87.1% 86.8% V5 (many diffs) n/a
3 TRCN0000472126 GTCGTTAATGTTATGAGCGTACCG pLX_317 100% 87.1% 86.8% V5 (many diffs) n/a
Download CSV