Transcript: Mouse XM_006508294.2

PREDICTED: Mus musculus RAB30, member RAS oncogene family (Rab30), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rab30 (75985)
Length:
9550
CDS:
343..954

Additional Resources:

NCBI RefSeq record:
XM_006508294.2
NBCI Gene record:
Rab30 (75985)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508294.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348722 ACGTGCCTAGTCCGAAGATTC pLKO_005 409 CDS 100% 10.800 15.120 N Rab30 n/a
2 TRCN0000047828 GCATCAGCTATTTGACTTGTT pLKO.1 920 CDS 100% 4.950 6.930 N RAB30 n/a
3 TRCN0000100402 CGAAGATTCACTCAGGGTCTT pLKO.1 421 CDS 100% 4.050 5.670 N Rab30 n/a
4 TRCN0000100401 CAGCTATTTGACTTGTTGTAA pLKO.1 924 CDS 100% 5.625 3.938 N Rab30 n/a
5 TRCN0000100403 CTTGATCCTTACCTATGACAT pLKO.1 594 CDS 100% 4.950 3.465 N Rab30 n/a
6 TRCN0000351959 CTTGATCCTTACCTATGACAT pLKO_005 594 CDS 100% 4.950 3.465 N Rab30 n/a
7 TRCN0000047831 GAAGATTCACTCAGGGTCTTT pLKO.1 422 CDS 100% 4.950 3.465 N RAB30 n/a
8 TRCN0000100400 GCAGTCTTCTTCAGTCTCATT pLKO.1 1671 3UTR 100% 4.950 3.465 N Rab30 n/a
9 TRCN0000351884 GCAGTCTTCTTCAGTCTCATT pLKO_005 1671 3UTR 100% 4.950 3.465 N Rab30 n/a
10 TRCN0000100404 CGGGAGATAGAACAGTATGCT pLKO.1 655 CDS 100% 3.000 2.100 N Rab30 n/a
11 TRCN0000351883 CGGGAGATAGAACAGTATGCT pLKO_005 655 CDS 100% 3.000 2.100 N Rab30 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508294.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03027 pDONR223 100% 94% 100% None (many diffs) n/a
2 ccsbBroad304_03027 pLX_304 0% 94% 100% V5 (many diffs) n/a
3 TRCN0000468748 ATTTCAACAACACGAGCGACACAT pLX_317 81% 94% 100% V5 (many diffs) n/a
Download CSV