Transcript: Mouse XM_006508298.3

PREDICTED: Mus musculus phospholysine phosphohistidine inorganic pyrophosphate phosphatase (Lhpp), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lhpp (76429)
Length:
1295
CDS:
93..563

Additional Resources:

NCBI RefSeq record:
XM_006508298.3
NBCI Gene record:
Lhpp (76429)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508298.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081166 GCTGCTGAAGTACACGGACAA pLKO.1 539 CDS 100% 4.050 2.835 N Lhpp n/a
2 TRCN0000081163 CCTTTAATTGACCATCCAATT pLKO.1 940 3UTR 100% 1.080 0.756 N Lhpp n/a
3 TRCN0000363563 CCTTTAATTGACCATCCAATT pLKO_005 940 3UTR 100% 1.080 0.756 N Lhpp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508298.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08826 pDONR223 100% 48.8% 51.8% None (many diffs) n/a
2 ccsbBroad304_08826 pLX_304 0% 48.8% 51.8% V5 (many diffs) n/a
3 ccsbBroadEn_08825 pDONR223 100% 29.6% 31.8% None (many diffs) n/a
4 ccsbBroad304_08825 pLX_304 0% 29.6% 31.8% V5 (many diffs) n/a
5 TRCN0000474036 ACCACTCGTTCGCAAAAAGCTTTT pLX_317 71.3% 29.6% 31.8% V5 (many diffs) n/a
Download CSV