Transcript: Mouse XM_006510819.2

PREDICTED: Mus musculus SMAD family member 3 (Smad3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smad3 (17127)
Length:
4617
CDS:
39..1121

Additional Resources:

NCBI RefSeq record:
XM_006510819.2
NBCI Gene record:
Smad3 (17127)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510819.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314050 TCCGTATGAGCTTCGTCAAAG pLKO_005 958 CDS 100% 10.800 15.120 N Smad3 n/a
2 TRCN0000089027 CATCCGTATGAGCTTCGTCAA pLKO.1 956 CDS 100% 4.050 5.670 N Smad3 n/a
3 TRCN0000314114 CACCGATTCCACTCAACTAAG pLKO_005 1216 3UTR 100% 10.800 8.640 N Smad3 n/a
4 TRCN0000314116 TTAGAGACACTAGGAGTAAAG pLKO_005 1118 CDS 100% 10.800 7.560 N Smad3 n/a
5 TRCN0000089025 CCTTACCACTATCAGAGAGTA pLKO.1 213 CDS 100% 4.950 3.465 N Smad3 n/a
6 TRCN0000089024 GCACACAATAACTTGGACCTA pLKO.1 486 CDS 100% 2.640 1.848 N Smad3 n/a
7 TRCN0000089023 CCCATGTTTCTGCATGGATTT pLKO.1 2319 3UTR 100% 1.080 0.756 N Smad3 n/a
8 TRCN0000020010 CCGCTGTTCCAGTGTGTCTTA pLKO.1 1100 CDS 100% 4.950 2.970 N SMAD3 n/a
9 TRCN0000020012 CATCTCCTACTACGAGCTGAA pLKO.1 545 CDS 100% 4.050 2.430 N SMAD3 n/a
10 TRCN0000089026 CTGTCCAATGTCAACCGGAAT pLKO.1 663 CDS 100% 4.050 2.430 N Smad3 n/a
11 TRCN0000317914 CTGTCCAATGTCAACCGGAAT pLKO_005 663 CDS 100% 4.050 2.430 N Smad3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510819.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06549 pDONR223 100% 77.7% 83.7% None (many diffs) n/a
2 ccsbBroad304_06549 pLX_304 52.9% 77.7% 83.7% V5 (many diffs) n/a
3 TRCN0000469603 CAAACTTGGTTGGCATGCAAAGAT pLX_317 28.1% 77.7% 83.7% V5 (many diffs) n/a
Download CSV