Transcript: Mouse XM_006511511.3

PREDICTED: Mus musculus armadillo repeat containing 8 (Armc8), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Armc8 (74125)
Length:
4583
CDS:
299..2224

Additional Resources:

NCBI RefSeq record:
XM_006511511.3
NBCI Gene record:
Armc8 (74125)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511511.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216837 GAACAGTTATTCCGGTTATTG pLKO.1 1838 CDS 100% 13.200 10.560 N Armc8 n/a
2 TRCN0000202125 CGAGGACTGTTGTGTTGTGTT pLKO.1 2413 3UTR 100% 4.950 3.960 N Armc8 n/a
3 TRCN0000246482 TCTACTAGACTGCCATATTAT pLKO_005 598 CDS 100% 15.000 10.500 N Armc8 n/a
4 TRCN0000246483 ATTTCCTTTGGACCTACAATT pLKO_005 2482 3UTR 100% 13.200 9.240 N Armc8 n/a
5 TRCN0000246485 CCGCTACACCCAGGAGTATAT pLKO_005 778 CDS 100% 13.200 9.240 N Armc8 n/a
6 TRCN0000246486 TGAACAGTTATTCCGGTTATT pLKO_005 1837 CDS 100% 13.200 9.240 N Armc8 n/a
7 TRCN0000246484 TGCCATGCTGGCTGACTATTT pLKO_005 1273 CDS 100% 13.200 9.240 N Armc8 n/a
8 TRCN0000191250 CGGATTCATCTTGAGAACATT pLKO.1 2370 3UTR 100% 5.625 3.938 N Armc8 n/a
9 TRCN0000168419 GTGAAGATGTTACAGAGGGAT pLKO.1 1019 CDS 100% 2.640 1.848 N ARMC8 n/a
10 TRCN0000319014 GTGAAGATGTTACAGAGGGAT pLKO_005 1019 CDS 100% 2.640 1.848 N ARMC8 n/a
11 TRCN0000202276 GCCTATCTGATTGAGCCAGAT pLKO.1 1211 CDS 100% 0.405 0.284 N Armc8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511511.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02872 pDONR223 100% 55.3% 57% None (many diffs) n/a
2 ccsbBroad304_02872 pLX_304 0% 55.3% 57% V5 (many diffs) n/a
3 TRCN0000474364 GCAATCAGATGATACCTCGAAGCC pLX_317 45.2% 55.3% 57% V5 (many diffs) n/a
Download CSV