Transcript: Mouse XM_006511551.2

PREDICTED: Mus musculus family with sequence similarity 81, member A (Fam81a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam81a (76886)
Length:
3746
CDS:
396..1490

Additional Resources:

NCBI RefSeq record:
XM_006511551.2
NBCI Gene record:
Fam81a (76886)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511551.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177802 CAATGAAAGAGACGTAGAGAA pLKO.1 1178 CDS 100% 4.950 3.960 N Fam81a n/a
2 TRCN0000198558 GAGCGGATAGAGAAAGAACTT pLKO.1 1107 CDS 100% 4.950 3.960 N Fam81a n/a
3 TRCN0000198574 GAGATGAAAGCGGAGGTTAAT pLKO.1 1341 CDS 100% 13.200 9.240 N Fam81a n/a
4 TRCN0000198878 GCTGTTCTTGGAAGAGCATAT pLKO.1 614 CDS 100% 10.800 7.560 N Fam81a n/a
5 TRCN0000181729 GCCATTGTGAAGCAACTGAAT pLKO.1 648 CDS 100% 4.950 3.465 N Fam81a n/a
6 TRCN0000198851 CCAATGAAAGAGACGTAGAGA pLKO.1 1177 CDS 100% 3.000 2.100 N Fam81a n/a
7 TRCN0000182047 CACTTGAACAAGGAACAGCAA pLKO.1 861 CDS 100% 2.640 1.848 N Fam81a n/a
8 TRCN0000182807 CCAACTTCAGAAGCAGATCCA pLKO.1 1439 CDS 100% 2.640 1.848 N Fam81a n/a
9 TRCN0000145069 CTATGGAACTAATTCTGCCTT pLKO.1 719 CDS 100% 2.640 1.848 N FAM81A n/a
10 TRCN0000181630 GCTATGGAACTAATTCTGCCT pLKO.1 718 CDS 100% 0.660 0.462 N Fam81a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511551.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10479 pDONR223 100% 87.2% 92.6% None (many diffs) n/a
2 ccsbBroad304_10479 pLX_304 0% 87.2% 92.6% V5 (many diffs) n/a
3 TRCN0000477726 AACGTCGCCGTGAGGATTGATTAT pLX_317 37% 87.1% 65.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV