Transcript: Mouse XM_006511565.3

PREDICTED: Mus musculus pleckstrin homology domain interacting protein (Phip), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Phip (83946)
Length:
10779
CDS:
759..5714

Additional Resources:

NCBI RefSeq record:
XM_006511565.3
NBCI Gene record:
Phip (83946)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511565.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239003 TTGAATGTAGGTCGCTAATTT pLKO_005 3673 CDS 100% 15.000 21.000 N Phip n/a
2 TRCN0000239005 GGAGTCAAAGTTCGATCTTAT pLKO_005 1743 CDS 100% 13.200 18.480 N Phip n/a
3 TRCN0000239004 GTAGATTATCTGAGCTATAAA pLKO_005 9723 3UTR 100% 15.000 10.500 N Phip n/a
4 TRCN0000147136 CCAGGAACCATTCAAGTAAAT pLKO.1 5103 CDS 100% 13.200 9.240 N PHIP n/a
5 TRCN0000239001 GTGATGGGACAGCACGAATTT pLKO_005 1402 CDS 100% 13.200 9.240 N Phip n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511565.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14184 pDONR223 100% 45.5% 47% None (many diffs) n/a
2 ccsbBroad304_14184 pLX_304 0% 45.5% 47% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000473480 TAACTAACCTCAAGATTCCCCTTC pLX_317 16.8% 45.5% 47% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_12139 pDONR223 100% 37.8% 39% None (many diffs) n/a
5 ccsbBroad304_12139 pLX_304 0% 37.8% 39% V5 (many diffs) n/a
6 TRCN0000470046 AGTGATCTGCATAGGTAATGGCGC pLX_317 20.3% 37.8% 39% V5 (many diffs) n/a
Download CSV