Transcript: Mouse XM_006511617.3

PREDICTED: Mus musculus mitogen-activated protein kinase-activated protein kinase 3 (Mapkapk3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mapkapk3 (102626)
Length:
2355
CDS:
112..1098

Additional Resources:

NCBI RefSeq record:
XM_006511617.3
NBCI Gene record:
Mapkapk3 (102626)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511617.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412509 CCACTATGCGGGTAGACTATG pLKO_005 968 CDS 100% 10.800 15.120 N Mapkapk3 n/a
2 TRCN0000024190 GCAGAGATAATGCGGGACATT pLKO.1 379 CDS 100% 4.950 6.930 N Mapkapk3 n/a
3 TRCN0000055176 TCCTTGGATCAATCAATCCAT pLKO.1 852 CDS 100% 0.300 0.420 N Mapkapk3 n/a
4 TRCN0000024192 CCTGGACGTGTATGAGAATAT pLKO.1 249 CDS 100% 13.200 9.240 N Mapkapk3 n/a
5 TRCN0000429447 GCCAGGCTGACAGACTGTAAT pLKO_005 1118 3UTR 100% 13.200 9.240 N Mapkapk3 n/a
6 TRCN0000024189 GCTAACGATCATGCAGTTTAT pLKO.1 825 CDS 100% 13.200 9.240 N Mapkapk3 n/a
7 TRCN0000024193 ACAAGGATGCAACAACCAGTA pLKO.1 1077 CDS 100% 4.050 2.835 N Mapkapk3 n/a
8 TRCN0000055174 CCTGAATGGTTAGATGTCTCT pLKO.1 751 CDS 100% 2.640 1.848 N Mapkapk3 n/a
9 TRCN0000024191 GCTGTACTTAAACTCACCGAT pLKO.1 490 CDS 100% 2.640 1.848 N Mapkapk3 n/a
10 TRCN0000433855 GTTGTCTTATGTGTCACATTG pLKO_005 1197 3UTR 100% 10.800 6.480 N Mapkapk3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511617.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01836 pDONR223 100% 76.4% 78.6% None (many diffs) n/a
2 ccsbBroad304_01836 pLX_304 0% 76.4% 78.6% V5 (many diffs) n/a
3 TRCN0000472636 CATGCACCTCCGACAATCCGGGCT pLX_317 17.8% 76.4% 78.6% V5 (many diffs) n/a
4 ccsbBroadEn_14887 pDONR223 0% 76.4% 78.6% None (many diffs) n/a
5 ccsbBroad304_14887 pLX_304 0% 76.4% 78.6% V5 (many diffs) n/a
6 TRCN0000480399 GCCCCCGCTTATCCTTTAGTCGCA pLX_317 30.3% 76.4% 78.6% V5 (many diffs) n/a
7 TRCN0000488944 CCACTAAATTGGAGTTATGCTGCA pLX_317 26% 76.4% 78.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV