Transcript: Mouse XM_006511831.3

PREDICTED: Mus musculus POC1 centriolar protein A (Poc1a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Poc1a (70235)
Length:
1710
CDS:
416..1459

Additional Resources:

NCBI RefSeq record:
XM_006511831.3
NBCI Gene record:
Poc1a (70235)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511831.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000189619 CCGGGAATGTATCCACTCATA pLKO.1 943 CDS 100% 4.950 6.930 N Poc1a n/a
2 TRCN0000201937 CCCAATGTCAAAGGTGAGTCA pLKO.1 683 CDS 100% 2.640 3.696 N Poc1a n/a
3 TRCN0000191416 CAAAGGTGAGTCAACTGTATT pLKO.1 691 CDS 100% 13.200 9.240 N Poc1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511831.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02878 pDONR223 100% 76.6% 75.9% None (many diffs) n/a
2 ccsbBroad304_02878 pLX_304 0% 76.6% 75.9% V5 (many diffs) n/a
3 TRCN0000469250 GAACATGTGATCCGCGTTGTGCGT pLX_317 36.9% 76.6% 75.9% V5 (many diffs) n/a
4 ccsbBroadEn_11778 pDONR223 100% 67.2% 66.5% None (many diffs) n/a
5 ccsbBroad304_11778 pLX_304 0% 67.2% 66.5% V5 (many diffs) n/a
6 TRCN0000469531 TGATGTTGGCGCACACCTGGGAAC pLX_317 46.4% 67.2% 66.5% V5 (many diffs) n/a
Download CSV