Transcript: Mouse XM_006512567.1

PREDICTED: Mus musculus large tumor suppressor (Lats1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lats1 (16798)
Length:
2833
CDS:
375..2390

Additional Resources:

NCBI RefSeq record:
XM_006512567.1
NBCI Gene record:
Lats1 (16798)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512567.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022942 GCAACATTCAATTAACCGAAA pLKO.1 878 CDS 100% 4.050 5.670 N Lats1 n/a
2 TRCN0000274543 GCAACATTCAATTAACCGAAA pLKO_005 878 CDS 100% 4.050 5.670 N Lats1 n/a
3 TRCN0000022943 GCCCAACAGGAACAGTCATAA pLKO.1 1604 CDS 100% 13.200 10.560 N Lats1 n/a
4 TRCN0000022940 CCACCCAAATTTGGCACACAT pLKO.1 576 CDS 100% 4.950 3.465 N Lats1 n/a
5 TRCN0000022941 CCTATTCAACAGCCCGTGAAA pLKO.1 1848 CDS 100% 4.950 3.465 N Lats1 n/a
6 TRCN0000274541 CCTATTCAACAGCCCGTGAAA pLKO_005 1848 CDS 100% 4.950 3.465 N Lats1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512567.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11336 pDONR223 100% 84.3% 87.5% None (many diffs) n/a
2 ccsbBroad304_11336 pLX_304 0% 84.3% 87.5% V5 (many diffs) n/a
3 TRCN0000470200 GCACGCCCAACACTTTTACGTCTA pLX_317 18.8% 84.3% 87.5% V5 (many diffs) n/a
4 ccsbBroadEn_14930 pDONR223 0% 84.3% 87.5% None (many diffs) n/a
5 ccsbBroad304_14930 pLX_304 0% 84.3% 87.5% V5 (many diffs) n/a
6 TRCN0000472788 ACCGTGTACAGCAGCTCTCGGTAC pLX_317 23% 84.3% 87.5% V5 (many diffs) n/a
7 TRCN0000488803 CAAGTTGGGTTCATTTCCAAGGGG pLX_317 8% 51.5% 53.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV