Transcript: Mouse XM_006512702.2

PREDICTED: Mus musculus tumor necrosis factor, alpha-induced protein 3 (Tnfaip3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tnfaip3 (21929)
Length:
4378
CDS:
230..2557

Additional Resources:

NCBI RefSeq record:
XM_006512702.2
NBCI Gene record:
Tnfaip3 (21929)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512702.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362922 AGCTATCACTCATGGATATAA pLKO_005 1365 CDS 100% 15.000 21.000 N Tnfaip3 n/a
2 TRCN0000030964 GCACTCTATGTTTCATCGAAT pLKO.1 2055 CDS 100% 4.950 6.930 N Tnfaip3 n/a
3 TRCN0000030966 GCTATCACTCATGGATATAAA pLKO.1 1366 CDS 100% 15.000 10.500 N Tnfaip3 n/a
4 TRCN0000378470 ATGGGATCATCTATCACTTTA pLKO_005 330 CDS 100% 13.200 9.240 N Tnfaip3 n/a
5 TRCN0000030968 CTGTGAAGATACGAGAGAGAA pLKO.1 282 CDS 100% 4.950 3.465 N Tnfaip3 n/a
6 TRCN0000030965 CCTTTGAAAGTGGGTGGGATT pLKO.1 905 CDS 100% 4.050 2.835 N Tnfaip3 n/a
7 TRCN0000030967 CCTGGAAGAAATCCACATATT pLKO.1 799 CDS 100% 13.200 7.920 N Tnfaip3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512702.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01686 pDONR223 100% 83.6% 88.1% None (many diffs) n/a
2 ccsbBroad304_01686 pLX_304 27.8% 83.6% 68.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_11197 pDONR223 100% 27.2% 26.9% None (many diffs) n/a
4 ccsbBroad304_11197 pLX_304 0% 27.2% 26.9% V5 (many diffs) n/a
5 TRCN0000472676 TCCTGCTTCATCACAGCACTAGCA pLX_317 58.2% 27.2% 26.9% V5 (many diffs) n/a
Download CSV