Transcript: Mouse XM_006513065.1

PREDICTED: Mus musculus adenosine deaminase, RNA-specific, B1 (Adarb1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adarb1 (110532)
Length:
6616
CDS:
474..2561

Additional Resources:

NCBI RefSeq record:
XM_006513065.1
NBCI Gene record:
Adarb1 (110532)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513065.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424266 GAAGTGTATCAACGGTGAATA pLKO_005 1580 CDS 100% 13.200 18.480 N Adarb1 n/a
2 TRCN0000416810 ACAATCCCTGTGCGCTCAAAT pLKO_005 1923 CDS 100% 13.200 9.240 N Adarb1 n/a
3 TRCN0000434376 ACCAGCGGATCTCCAACATAG pLKO_005 2137 CDS 100% 10.800 7.560 N ADARB1 n/a
4 TRCN0000086463 CCACTGGACATCAAGCATCAT pLKO.1 2679 3UTR 100% 4.950 3.465 N Adarb1 n/a
5 TRCN0000086467 AGATCACTAAGCCTACCACAT pLKO.1 2407 CDS 100% 4.050 2.835 N Adarb1 n/a
6 TRCN0000086464 CCAGCAGATAGACATCCGAAT pLKO.1 1854 CDS 100% 4.050 2.835 N Adarb1 n/a
7 TRCN0000086466 GTGATGATCTTGAATGAGCTA pLKO.1 1164 CDS 100% 2.640 1.848 N Adarb1 n/a
8 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 5024 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513065.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05771 pDONR223 100% 86.7% 93.4% None (many diffs) n/a
2 ccsbBroad304_05771 pLX_304 0% 86.7% 93.4% V5 (many diffs) n/a
3 TRCN0000480349 GCGGACAATTTATAATCGTCATTG pLX_317 18% 86.7% 93.4% V5 (many diffs) n/a
Download CSV