Transcript: Mouse XM_006513243.3

PREDICTED: Mus musculus hexokinase 1 (Hk1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hk1 (15275)
Length:
3928
CDS:
352..3120

Additional Resources:

NCBI RefSeq record:
XM_006513243.3
NBCI Gene record:
Hk1 (15275)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513243.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012532 GAGCCTAGATTGCGGAATCTT pLKO.1 2190 CDS 100% 0.563 0.788 N Hk1 n/a
2 TRCN0000297387 GAGCCTAGATTGCGGAATCTT pLKO_005 2190 CDS 100% 0.563 0.788 N Hk1 n/a
3 TRCN0000012531 CGTAGACGGTTCTCTCTACAA pLKO.1 1596 CDS 100% 0.495 0.693 N Hk1 n/a
4 TRCN0000278070 CGTAGACGGTTCTCTCTACAA pLKO_005 1596 CDS 100% 0.495 0.693 N Hk1 n/a
5 TRCN0000012528 GCTGCTGAATAAAGCCATTAA pLKO.1 924 CDS 100% 13.200 9.240 N Hk1 n/a
6 TRCN0000297076 GCTGCTGAATAAAGCCATTAA pLKO_005 924 CDS 100% 13.200 9.240 N Hk1 n/a
7 TRCN0000012530 CCTGATTGACTTCACCAAGAA pLKO.1 2634 CDS 100% 4.950 3.465 N Hk1 n/a
8 TRCN0000278141 CCTGATTGACTTCACCAAGAA pLKO_005 2634 CDS 100% 4.950 3.465 N Hk1 n/a
9 TRCN0000012529 CCATCCACACTTCTCCAGAAT pLKO.1 2964 CDS 100% 4.950 2.970 N Hk1 n/a
10 TRCN0000278069 CCATCCACACTTCTCCAGAAT pLKO_005 2964 CDS 100% 4.950 2.970 N Hk1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513243.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06367 pDONR223 100% 84.7% 89.4% None (many diffs) n/a
2 ccsbBroad304_06367 pLX_304 0% 84.7% 89.4% V5 (many diffs) n/a
3 TRCN0000470675 TCGCTAGCGATCTATTCATATTGA pLX_317 .5% 84.7% 89.4% V5 (many diffs) n/a
4 ccsbBroadEn_14665 pDONR223 0% 84.7% 89.4% None (many diffs) n/a
5 ccsbBroad304_14665 pLX_304 0% 84.7% 89.4% V5 (many diffs) n/a
6 TRCN0000479797 GCTTGGCTTGCGGGAATCTAGTAA pLX_317 12.7% 84.7% 89.4% V5 (many diffs) n/a
7 TRCN0000488283 CCTGTCTCTCCCGGCTGCTCGTGG pLX_317 11.8% 84.7% 89.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV