Transcript: Mouse XM_006513626.2

PREDICTED: Mus musculus cyclin-dependent kinase 17 (Cdk17), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdk17 (237459)
Length:
3334
CDS:
62..1681

Additional Resources:

NCBI RefSeq record:
XM_006513626.2
NBCI Gene record:
Cdk17 (237459)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146845 ACATAGACGGATCTCAATGG pXPR_003 AGG 460 28% 4 1.0207 Cdk17 CDK17 76788
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513626.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362229 ACAAGCCACAACCTCTAATTA pLKO_005 1398 CDS 100% 15.000 21.000 N Cdk17 n/a
2 TRCN0000006241 GCGGAATCATTGCTGCTAAAT pLKO.1 1990 3UTR 100% 13.200 18.480 N CDK17 n/a
3 TRCN0000297344 GCGGAATCATTGCTGCTAAAT pLKO_005 1990 3UTR 100% 13.200 18.480 N CDK17 n/a
4 TRCN0000023170 GCCTCAGAAATCGTATACATA pLKO.1 489 CDS 100% 5.625 7.875 N Cdk17 n/a
5 TRCN0000023171 CCCACAAAGACCTACTCAAAT pLKO.1 1130 CDS 100% 13.200 10.560 N Cdk17 n/a
6 TRCN0000362154 TTGCCCGAGAGCGTATCAATA pLKO_005 1556 CDS 100% 13.200 10.560 N Cdk17 n/a
7 TRCN0000362152 GTGCACCCTGTACAGCTATAA pLKO_005 798 CDS 100% 13.200 9.240 N Cdk17 n/a
8 TRCN0000362231 AGTAGGTTACAGCTATCAATG pLKO_005 1915 3UTR 100% 10.800 7.560 N Cdk17 n/a
9 TRCN0000023169 CCAGGTTAGATTCTGAAGGAA pLKO.1 1428 CDS 100% 3.000 2.100 N Cdk17 n/a
10 TRCN0000023173 GCAGACATCAGGATACCTGAT pLKO.1 554 CDS 100% 0.405 0.284 N Cdk17 n/a
11 TRCN0000023172 CCAGGTGTTTCTTCAAATGAT pLKO.1 1349 CDS 100% 5.625 3.375 N Cdk17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513626.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01156 pDONR223 100% 87.8% 95.7% None (many diffs) n/a
2 ccsbBroad304_01156 pLX_304 0% 87.8% 95.7% V5 (many diffs) n/a
3 TRCN0000465231 TTTGATACAAACCTCAAATCAGCC pLX_317 14% 87.8% 95.7% V5 (many diffs) n/a
4 ccsbBroadEn_14731 pDONR223 0% 87.8% 95.7% None (many diffs) n/a
5 ccsbBroad304_14731 pLX_304 0% 87.8% 95.7% V5 (many diffs) n/a
6 TRCN0000468143 AAGTCCCTTTCATCCGCTTGAGTT pLX_317 26.5% 87.8% 95.7% V5 (many diffs) n/a
7 TRCN0000488011 TCACCTCCAGCAGAACGCTGCTGA pLX_317 21.5% 87.8% 95.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV