Transcript: Mouse XM_006514456.3

PREDICTED: Mus musculus sprouty-related, EVH1 domain containing 2 (Spred2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Spred2 (114716)
Length:
20875
CDS:
17013..18296

Additional Resources:

NCBI RefSeq record:
XM_006514456.3
NBCI Gene record:
Spred2 (114716)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514456.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066277 GCTACGGACAGTTCTTCTAAT pLKO.1 17505 CDS 100% 13.200 18.480 N Spred2 n/a
2 TRCN0000303154 GCTACGGACAGTTCTTCTAAT pLKO_005 17505 CDS 100% 13.200 18.480 N Spred2 n/a
3 TRCN0000056830 CAGCTATATTGTGCGTGTCAA pLKO.1 17093 CDS 100% 4.950 6.930 N SPRED2 n/a
4 TRCN0000066273 CCCAAACACGAATATACCTAT pLKO.1 17826 CDS 100% 4.950 3.465 N Spred2 n/a
5 TRCN0000066275 GAAGGTTGATAACAGGAAGTT pLKO.1 17336 CDS 100% 4.950 3.465 N Spred2 n/a
6 TRCN0000303152 GAAGGTTGATAACAGGAAGTT pLKO_005 17336 CDS 100% 4.950 3.465 N Spred2 n/a
7 TRCN0000066274 GAGACTACACTGACCCTTGTT pLKO.1 18115 CDS 100% 4.950 3.465 N Spred2 n/a
8 TRCN0000303226 GAGACTACACTGACCCTTGTT pLKO_005 18115 CDS 100% 4.950 3.465 N Spred2 n/a
9 TRCN0000066276 AGGGATATGTTTAATCACGAA pLKO.1 17976 CDS 100% 2.640 1.848 N Spred2 n/a
10 TRCN0000303153 AGGGATATGTTTAATCACGAA pLKO_005 17976 CDS 100% 2.640 1.848 N Spred2 n/a
11 TRCN0000056829 AGAAAGACAAACTGGTGGTAT pLKO.1 17254 CDS 100% 4.950 2.970 N SPRED2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514456.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000476321 CTGGATCGCTCCCCTCCTTGCGCC pLX_317 30.4% 82.6% 87.1% V5 (many diffs) n/a
2 ccsbBroadEn_05192 pDONR223 100% 82.6% 86.8% None (many diffs) n/a
3 ccsbBroad304_05192 pLX_304 0% 82.6% 86.8% V5 (many diffs) n/a
Download CSV