Transcript: Mouse XM_006514567.1

PREDICTED: Mus musculus ubiquitin specific peptidase 34 (Usp34), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Usp34 (17847)
Length:
11184
CDS:
129..10631

Additional Resources:

NCBI RefSeq record:
XM_006514567.1
NBCI Gene record:
Usp34 (17847)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514567.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218863 ATGGATGAGCAGCTTATTAAT pLKO_005 1743 CDS 100% 15.000 21.000 N Usp34 n/a
2 TRCN0000257239 AGATTGAGGGCACCGGTATTA pLKO_005 3808 CDS 100% 13.200 18.480 N Usp34 n/a
3 TRCN0000234169 GACAGAGTGCGGCTCGTAATA pLKO_005 982 CDS 100% 13.200 18.480 N Usp34 n/a
4 TRCN0000234170 GAAGCACTGTAGTCGATATAT pLKO_005 1382 CDS 100% 15.000 12.000 N Usp34 n/a
5 TRCN0000230383 GCTGTGGCCTGGCAGTATATA pLKO_005 11105 3UTR 100% 15.000 10.500 N USP34 n/a
6 TRCN0000038844 CCAGAGAATATCCGCCTTATT pLKO.1 8679 CDS 100% 13.200 9.240 N USP34 n/a
7 TRCN0000038845 GCGACTTATGTCTGTTGCTTA pLKO.1 5027 CDS 100% 4.950 3.465 N USP34 n/a
8 TRCN0000234171 CAAGATGATGATGCAATTAAT pLKO_005 2841 CDS 100% 15.000 9.000 N Usp34 n/a
9 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 2001 CDS 100% 4.950 2.475 Y PTMA n/a
10 TRCN0000092696 GAAGATGAAGAAGAAGATGAT pLKO.1 2055 CDS 100% 4.950 2.475 Y Hmgb1-ps7 n/a
11 TRCN0000093079 GATGAAGAAGAAGATGATGAT pLKO.1 2058 CDS 100% 4.950 2.475 Y Gm5518 n/a
12 TRCN0000121617 GAAGAAGAAGAAGAGGAAGAA pLKO.1 2013 CDS 100% 4.950 2.475 Y ARL6IP4 n/a
13 TRCN0000150618 GAAGAGGAAGAAGATGATGAT pLKO.1 2028 CDS 100% 4.950 2.475 Y SAMD1 n/a
14 TRCN0000190517 GAGGAGGAAGAAGAAGAAGAA pLKO.1 2007 CDS 100% 4.950 2.475 Y G430095P16Rik n/a
15 TRCN0000163739 GAAGAAGAGGAAGAGGAGGAA pLKO.1 1992 CDS 100% 2.640 1.320 Y CCDC88B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514567.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.