Transcript: Mouse XM_006514625.3

PREDICTED: Mus musculus aftiphilin (Aftph), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Aftph (216549)
Length:
4136
CDS:
284..3169

Additional Resources:

NCBI RefSeq record:
XM_006514625.3
NBCI Gene record:
Aftph (216549)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514625.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174410 CGTTATGACACCAGAAATAAA pLKO.1 2620 CDS 100% 15.000 21.000 N Aftph n/a
2 TRCN0000277408 GCTAGTCATGCTACGGAATTT pLKO_005 956 CDS 100% 13.200 18.480 N Aftph n/a
3 TRCN0000193718 CCTGTTATAGTGCCCATGTAT pLKO.1 2510 CDS 100% 5.625 4.500 N Aftph n/a
4 TRCN0000277342 ACATACCGAAGTCCTAAATTT pLKO_005 3333 3UTR 100% 15.000 10.500 N Aftph n/a
5 TRCN0000277341 GCCCACCAAGGAACCATTAAA pLKO_005 2554 CDS 100% 15.000 10.500 N Aftph n/a
6 TRCN0000193227 CAACAGGATGAGTTTCTAAAT pLKO.1 1244 CDS 100% 13.200 9.240 N Aftph n/a
7 TRCN0000277411 CAACAGGATGAGTTTCTAAAT pLKO_005 1244 CDS 100% 13.200 9.240 N Aftph n/a
8 TRCN0000277410 TAGATAGCCTTACAAGCTTTA pLKO_005 507 CDS 100% 10.800 7.560 N Aftph n/a
9 TRCN0000193616 GCAAAGAAATGATTCCATCTA pLKO.1 618 CDS 100% 4.950 3.465 N Aftph n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514625.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12087 pDONR223 100% 12.8% 13% None (many diffs) n/a
2 ccsbBroad304_12087 pLX_304 0% 12.8% 13% V5 (many diffs) n/a
3 TRCN0000465493 CTCGCACGTAGCCTCCAGTGACCG pLX_317 49.5% 12.8% 13% V5 (many diffs) n/a
Download CSV